We narrowed to 1,257 results for: cas12
-
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH130 (crCD55-4_crB2M-1_crKIT-2_crCD81-1)
Plasmid#217340PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA52_Lenti.puro.U6_modified DR
Plasmid#196723PurposeFor cloning pairs of AsCas12a guides with two DRs that are as different as possible.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRDA_887
Plasmid#245329PurposeCas12a CRISPRa cloning vector; contains NbALFA, p65DepositorTypeEmpty backboneUseLentiviralMutationNoneAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_246
Plasmid#245333PurposeCas12a CRISPRko positive control guide; targets CD47DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_245
Plasmid#245332PurposeCas12a CRISPRko positive control guide; targets CD46DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_247
Plasmid#245334PurposeCas12a CRISPRko positive control guide; targets CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA097
Plasmid#245319PurposeCas12a CRISPRko positive control; targets CD46, CD47, CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_248
Plasmid#245335PurposeCas12a CRISPRko positive control guide; targets CD63DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_908
Plasmid#245330PurposeCas12a CRISPRa positive control guide; targets CD274, ADGRE5, CD4, DPP4DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
INT_SS9sp
Plasmid#212145PurposeEffector plasmid for for operon integration into the genome (Safe Site 9) using CRISPR-Cas12a. Plasmid can be removed by incubating cells at 37 C.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, VchTnsA, VchTnsB, VchTnsC
ExpressionBacterialPromoterpJ23119Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHelper_AcCAST
Plasmid#127923PurposeExpresses AcCAST and a crRNA targeting PSP1DepositorInsertAcTnsB, AcTnsC, AcTniQ, AcCas12k
Available SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHelper_ShCAST
Plasmid#127922PurposeExpresses ShCAST and a crRNA targeting PSP1DepositorInsertShTnsB, ShTnsC, ShTniQ, ShCas12k
Available SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCA0.421
Plasmid#203950PurposeLevel 0 acceptor vector for assembling gRNA arrays for Cas12a in SP positionDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFSD-SIBR003
Plasmid#250973PurposeFSD expressing SIBR-Cas system with intron 3, contains restriction sites to introduce HR and spacer sequenceDepositorInsertSIBR003 system (SIBR Intron 3 FnCas12a)
ExpressionBacterialPromoterlacUV5Available SinceMarch 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFSD-SIBR004
Plasmid#250974PurposeFSD expressing SIBR-Cas system with intron 4, contains restriction sites to introduce HR and spacer sequenceDepositorInsertSIBR004 system (SIBR Intron 4 FnCas12a)
ExpressionBacterialPromoterlacUV5Available SinceMarch 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKJ247
Plasmid#228714PurposeMammalian expression of U6 epPsaCas12f RNF2 targeting guideDepositorArticleInsertu6-RNF2 targeting guide
UseCRISPRExpressionMammalianAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only