We narrowed to 1,708 results for: CAG promoter
-
Plasmid#245523PurposePlasmid for PiggyBac /ITR mediated insertion of F-Tractin sequence downstream of CAG promoter using Gateway recombination cassetteDepositorInsertF-Tractin-mKate2
ExpressionMammalianAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
APX1-pm-eGFP
Plasmid#245520PurposePlasmid for PiggyBac /ITR mediated insertion of pm-eGFP downstream of CAG promoter using Gateway recombination cassetteDepositorInsertpm-eGFP
ExpressionMammalianAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-chGrb2/eDHFR(69K6)-iRFP713
Plasmid#214828PurposeEncoding Grb2-eDHFR(69K6) chimera fused to iRFP713DepositorInsertGrb2(1-59)-eDHFR(69K6)-Grb2(152-216)-iRFP713
TagsiRFP713ExpressionMammalianPromoterCAG promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Neo-GFP/empty
Plasmid#105505PurposeEmpty backbone of MSCV-driven retroviral cDNA expressionDepositorTypeEmpty backboneUseRetroviralAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Target Zfp462-Klf4SE
Plasmid#127668PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter; 2 gRNAs targeting the Zfp462 promoter and 2 gRNAs targeting the Klf4 SE expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 129, 135, 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYap1-4
Plasmid#193670PurposeTet inducible knockdown of Yap1DepositorInsertYap1 (Yap1 Mouse)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shRBFOX1-3261
Plasmid#115458PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shCIAP2-A
Plasmid#44130DepositorInsertCIAP2
UseLentiviral and RNAiExpressionMammalianAvailable SinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-AAVS1-sg
Plasmid#194716PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target hAAVS1 locusDepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMH184
Plasmid#122857PurposeMS2-modified guide RNA targeting the FT promoter with GreenGate E-F flanking sequencesDepositorInsertMS2-modified sgRNA targeting the Arabidopsis FT promoter
UseGolden gate compatible cloning vectorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro
Plasmid#166133PurposeThis plasmid allows efficient KO of the cldn1 gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting cldn1 gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
KJ740(DE3)
Bacterial Strain#179486PurposeKJ740(DE3) is an OmpC-, OmpF-deletion strain of E. coli that allows for T7 promoter-based expressionDepositorBacterial ResistanceTetracycline (chromosome, Tn10) (10 μg/mL); Streptomycin/Spectinomycin (chromosome) (50 μg/mL)SpeciesEscherichia coliAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-Rictor-shRNA
Plasmid#157930PurposeKnockdown of RictorDepositorInsertRictor shRNA
UseLentiviral and RNAiTagstdTomatoPromotermouse U6Available SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - AAVS1 sgRNA
Plasmid#70661PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an AAVS1-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against AAVS1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shTRAF2#1
Plasmid#44127DepositorInsertTRAF2 (TRAF2 Human)
UseLentiviral and RNAiAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shTRAF2#2
Plasmid#44128DepositorInsertTRAF2 (TRAF2 Human)
UseLentiviral and RNAiAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBT009.119.DA9
Plasmid#206803PurposeExpresses DA9 scRNA for activation of pDA303DepositorInsertDA9 scRNA
PromoterJ23119Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-RtcAshRNA1
Plasmid#126613PurposeExpresses shRNA against human RtcA under mouse U6 promoterDepositorInsertRtcA shRNA-1
UseRNAiPromotermouse U6 promoterAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only