We narrowed to 1,718 results for: cag promoter
-
Plasmid#62659PurposeMammalian expression of FLPo recombinase from the broadly active CAG promoter/enhancerDepositorInsertFLPo
ExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCA-G-intron-T
Plasmid#36885DepositorInsertsGFP
tdTomato-3Myc
beta-globin intron
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCA-ATG-intron-tdT3Myc
Plasmid#36883DepositorInserttdTomato-3Myc
Tags3 Myc tagsExpressionMammalianMutationbeta-globin intron containing a loxP site inserte…PromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJM465 EF1α 3xFLAG-NLS-VP64-ZF1 in TUPV2
Plasmid#161533PurposeConstitutive expression of 3xFLAG-NLS-VP64-ZF1 under the EF1α promoterDepositorInsert3xFLAG-NLS-VP64-ZF1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterEF1αAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBT234_(pCA-G-intron-tTA2)
Plasmid#36874DepositorInsertsGFP
tTA2
beta-globin intron
ExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
APX1-pm-mKate2
Plasmid#245521PurposePlasmid for PiggyBac /ITR mediated insertion of pm-mKate2 sequence downstream of CAG promoter using Gateway recombination cassetteDepositorInsertpm-mKate2
ExpressionMammalianAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
APX1-F-Tractin-mKate2
Plasmid#245523PurposePlasmid for PiggyBac /ITR mediated insertion of F-Tractin sequence downstream of CAG promoter using Gateway recombination cassetteDepositorInsertF-Tractin-mKate2
ExpressionMammalianAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-chGrb2/eDHFR(69K6)-iRFP713
Plasmid#214828PurposeEncoding Grb2-eDHFR(69K6) chimera fused to iRFP713DepositorInsertGrb2(1-59)-eDHFR(69K6)-Grb2(152-216)-iRFP713
TagsiRFP713ExpressionMammalianPromoterCAG promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Neo-GFP/empty
Plasmid#105505PurposeEmpty backbone of MSCV-driven retroviral cDNA expressionDepositorTypeEmpty backboneUseRetroviralAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Target Zfp462-Klf4SE
Plasmid#127668PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter; 2 gRNAs targeting the Zfp462 promoter and 2 gRNAs targeting the Klf4 SE expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 129, 135, 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYap1-4
Plasmid#193670PurposeTet inducible knockdown of Yap1DepositorInsertYap1 (Yap1 Mouse)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shRBFOX1-3261
Plasmid#115458PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shCIAP2-A
Plasmid#44130DepositorInsertCIAP2
UseLentiviral and RNAiExpressionMammalianAvailable SinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
KJ740(DE3)
Bacterial Strain#179486PurposeKJ740(DE3) is an OmpC-, OmpF-deletion strain of E. coli that allows for T7 promoter-based expressionDepositorBacterial ResistanceTetracycline (chromosome, Tn10) (10 μg/mL); Streptomycin/Spectinomycin (chromosome) (50 μg/mL)SpeciesEscherichia coliAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-AAVS1-sg
Plasmid#194716PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target hAAVS1 locusDepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMH184
Plasmid#122857PurposeMS2-modified guide RNA targeting the FT promoter with GreenGate E-F flanking sequencesDepositorInsertMS2-modified sgRNA targeting the Arabidopsis FT promoter
UseGolden gate compatible cloning vectorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro
Plasmid#166133PurposeThis plasmid allows efficient KO of the cldn1 gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting cldn1 gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
csr-1_qa-2_dsimpα_bar
Plasmid#251402PurposeEnables inducible expression of double-stranded RNA targeting importin α (NCU01249) under the control of the qa-2 promoter, with the expression cassette inserted at the csr-1 locus.DepositorInsertimportin alpha
UseRNAiAvailable SinceMay 27, 2026AvailabilityAcademic Institutions and Nonprofits only