We narrowed to 4,733 results for: GCA
-
Plasmid#184872PurposeChromosomal transfer helper plasmid with sgRNAs (one fixed, one flexible) for in-vivo excision of transferred DNA for homologous recombination and counter-selection for successful integration.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pColE1_sgRNA_NT_AmpR
Plasmid#119144PurposeEncodes non-targeting sgRNADepositorInsertnon-targeting sgRNA
UseCrisprAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-puro-shWRN1
Plasmid#125783PurposeDOX-inducible expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN1 (WRN Human)
UseRNAiAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
shBIRC5 # 2
Plasmid#42554DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
SlugABEmax
Plasmid#163798PurposeExpresses ABEmax and nSlugCas9DepositorTypeEmpty backboneUseCRISPRExpressionMammalianMutationSlugCas9 (D10A)Available SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_human_ADAR1_ccC
Plasmid#158115Purposedeletion hADAR1DepositorInsertAdar1 (ADAR Human)
ExpressionMammalianAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro_shDDX58_230212
Plasmid#167293PurposeLentiviral plKO.1 construct coding for a short-hairpin RNA targeting the human gene DDX58 (coding for RLR sensor RIG-I). Contains a puro resistance cassette.DepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6.shRNA-Sdc1-1376
Plasmid#195574PurposeExpresses shRNA to knockdown mouse Syndecan-1DepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Bmi1_3
Plasmid#36354DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-H2B-jGCaMP8s-WPRE (AAV1)
Viral Prep#176749-AAV1PurposeReady-to-use AAV1 particles produced from AAV-Syn-H2B-jGCaMP8s-WPRE (#176749). In addition to the viral particles, you will also receive purified AAV-Syn-H2B-jGCaMP8s-WPRE plasmid DNA. Syn-driven expression of histone H2B fused to calcium sensor GCaMP8s. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-mDlx-jGCaMP8f-WPRE (AAV Retrograde)
Viral Prep#176753-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-mDlx-jGCaMP8f-WPRE (#176753). In addition to the viral particles, you will also receive purified AAV-mDlx-jGCaMP8f-WPRE plasmid DNA. mDlx-driven expression of ultrafast calcium sensor GCaMP8f. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28-AviTag-DogTag-MBP
Plasmid#171773PurposeExpresses AviTag-DogTag-Maltose binding protein in bacterial cytoplasm. The AviTag enables site-specific biotinylation by BirA.DepositorInsertAviTag-DogTag-MBP
TagsHis6 and Thrombin cleavage siteExpressionBacterialMutationPeptide tag added to N-terminus of MBP via a GSGE…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA
Plasmid#121954PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA
ExpressionMammalianAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter TCF (0)-(4) sites mutant pGL3Basic
Plasmid#32737DepositorInsertCCND1 promoter (CCND1 Human)
UseLuciferaseMutation-539 TCF(0) ATGAAAG deletion; -75 TCF(1) and -68 …Promoter-962 CCND1Available SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLentiX2-PURO-shGFP
Plasmid#61230PurposeLentivirus expressing shRNA to GFPDepositorInsertGFP
UseLentiviralPromoterH1/TOAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDD428
Plasmid#202081PurposeCas9/sgRNA plasmid targeting the C-terminus of Myh9DepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
EcMBP165-cpGFP.PPYF.T203V.pRSET
Plasmid#33373Purposea single-wavelength maltose sensor constructed from E. coli MalE and cpGFPDepositorInsertImproved MBP based Maltose Biosensor
Tags6xHISExpressionBacterialMutationcpGFP146 variant from GCaMP2 inserted between AA1…PromoterT7Available SinceDec. 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHJL4
Plasmid#199379PurposeEncodes dual cistronic cytosolic jGCaMP7f and mScarlet-I optimized for C. elegans expressionDepositorInsertjGCaMP7f::SL2::mScarlet-I
ExpressionBacterialMutationno mutationsAvailable SinceApril 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
PX458_CEBPB_2
Plasmid#64047PurposeExpresses gRNA against human CEBPB along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRPromoterU6Available SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only