We narrowed to 4,666 results for: Gca
-
Plasmid#209037PurposeLentiviral vector expressing mCherry along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_BRF2 (pAVA3258)
Plasmid#239326PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting BRF2DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting BRF2 (BRF2 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic-As
Plasmid#209036PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_3-As
Plasmid#218815PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
DGKE gRNA (BRDN0001147022)
Plasmid#76609Purpose3rd generation lentiviral gRNA plasmid targeting human DGKEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-HEK3-CTTins-px330-scaffold
Plasmid#180017PurposeTransiently expressing a pegRNA to introduce HEK3 CTT insertion in human cells. It has a sgRNA scaffold from px330.DepositorInsertPrime editing pegRNA for HEK3-CTTins, with px330 scaffold (EPHA8 Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD hCPS1 AD
Plasmid#188130PurposeExpresses C-terminal flag-tagged human CAD hCPS1 AD in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLED.CaRPv1
Plasmid#193018PurposeExcitatory/Inhibitory neuron calcium indicator (hSyn promoter, Synrg exon, jRGECO1a/jGCaMP7b)DepositorInsertBichromatic calcium indicator (jGCaMP7b and jRGECO1a)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ai162 (TIT2L-GC6s-ICL-tTA2) targeting vector
Plasmid#114433PurposeTarget a Cre-dependent GCaMP6s cassette and a tTA2 cassette into the mouse TIGRE locusDepositorInsertGCaMP6s, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai148 (TIT2L-GC6f-ICL-tTA2) targeting vector
Plasmid#114428PurposeTarget a Cre-dependent GCaMP6f expression and a tTA2 cassette into the mouse TIGRE locusDepositorInsertGCaMP6f
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasWT/sgKras/Cre
Plasmid#99848PurposeExpresses Cre-recombinase, a barcoded HDR template that serves as a control for HDR into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Ai163 (TIT2L-GC6s-ICL-TPT) targeting vector
Plasmid#114430PurposeTarget a Cre-dependent GCaMP6s cassette and a tdTomato-P2A-tTA2 cassette to the mouse TIGRE locusDepositorInsertGCaMP6s, tdTomato, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Plasmids for Multiplexed Optical Sensors Arrayed in Islands of Cells (MOSAIC)
Plasmid Kit#1000000175PurposePlasmids and entry vectors for diverse fluorescent sensors of physiological parameters in cells.DepositorAvailable SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
SGEP-shRLuc-802
Plasmid#188668Purposecontrol shRNADepositorInsertshRLuc
UseCRISPR and LentiviralMutationWTAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHJL4
Plasmid#199379PurposeEncodes dual cistronic cytosolic jGCaMP7f and mScarlet-I optimized for C. elegans expressionDepositorInsertjGCaMP7f::SL2::mScarlet-I
ExpressionBacterialMutationno mutationsAvailable SinceApril 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits