We narrowed to 28,463 results for: CAL
-
Plasmid#105944Purposeheat shock inducible transgenesis, non phoshorylable version of Plk4DepositorInsertPlk4 (Plk4 Mouse)
TagsmKate2ExpressionBacterialMutation1002 to 3704 of Plk4/ deletion of S282-S305.Available SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA_RGG-RFP-RGG
Plasmid#124934PurposeExpression of RGG-RFP-RGGDepositorInsertRGG-RFP-RGG (using LAF-1 RGG domain) (laf-1 Nematode)
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
FLAG-OTUB1 T134R-pcDNA3.1
Plasmid#118211PurposeExpresses FLAG-OTUB1 T134R mutant in mammalian cellsDepositorInsertOTUB1 (OTUB1 Human)
Tags3x FLAGExpressionMammalianMutationchanged threonine 134 to arginineAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-H2B-mRuby3-IRES-eGtACR1-ST
Plasmid#108960PurposeAnion channelrhodopsin GtACR1 fused to ER export signal and targeted to the neuronal soma and proximal dendrites under the control of internal ribosome entry sequenceDepositorInserteGtACR1-ST
ExpressionMammalianAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP-Poly(A)
Plasmid#65524PurposePlasmid for the generation of gene disruptions via Bxb1-mediated recombination into MIN-tagged cell lines. This vector can also be used to express cDNAs.DepositorInsertattB-GFP
UseMouse Targeting; Bxb1ExpressionMammalianAvailable SinceAug. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC1-Ift52
Plasmid#128875PurposeFor mammalian expression of mouse Ift52DepositorAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pN1-CMV-L-sDarken
Plasmid#184801PurposeLow affinity version of the Serotonin Sensor sDarken under the control of a CMV Promoter.DepositorInsertL-sDarken
ExpressionMammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD02_CBASS_Escherichia_coli_703128
Plasmid#224394PurposeFor expression of the type I CBASS system encoded by Escherichia coli 703128DepositorInsertEcCdnD_4TM
ExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD02_CBASS_Escherichia_coli_BWH59
Plasmid#224393PurposeFor expression of the type I CBASS system encoded by Escherichia coli BWH59DepositorInsert2TM_EcCdnD
ExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-DUET-GST-eIF4G1-His6, eIF4E
Plasmid#37232DepositorTagsGST and His6ExpressionBacterialPromoterT7Available SinceSept. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-mRuby3-2A-dCre
Plasmid#203845PurposeFlp-dependent enzymatically inactive Cre and mRuby3 expressionDepositorInsertdCre
UseAAVTagsmRuby3-2AMutationEnzymatically inactive CreAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFX-GalT-mCherry
Plasmid#174473PurposeExpress mCherry with golgi apparatus-targeting sequence in mammalian cellsDepositorInsertmCherry with golgi apparatus-targeting sequence
Tagsβ1,4-galactose transferaseExpressionMammalianPromoterCMVAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
MTK0_003
Plasmid#123925PurposeEncodes the spCas9 cassette and spCas9 gRNA GFP dropout expression cassette final destination vector as a type 0 part to be used in the MTK systemDepositorInsertCas9-sgRNA destination
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
RIPR-bio-His
Plasmid#50824PurposeExpresses enzymatically monobiotinylated full length RIPRDepositorInsertRIPR
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPD_Psra-6::ChR2(H134R)::mCherry
Plasmid#117419PurposeFor selectively expressing ChR2(H134R) in ASH sensory neurons under the expression of a Psra-6 promoterDepositorInsertchannel rhodopsin-2 with H134R mutation
ExpressionWormMutationH134RPromotersra-6Available SinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro human lipin 1-1 shRNA
Plasmid#32019DepositorInsertlipin1 shRNA
UseLentiviral and RNAiExpressionMammalianPromoterU6Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-iGABASnFR2n-WPRE
Plasmid#218884PurposeAAV-mediated expression of improved GABA sensor (negative change in fluorescence)DepositorInsertiGABASnFR2n
UseAAVExpressionMammalianMutationS99A F104H R168PPromoterCAGAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCOLA-Gent-yibDp-Erv1p
Plasmid#202483PurposeExpresses sulfydryl oxidase (Erv1p) after phosphate depletionDepositorAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
XE122 XDsh delta DIX-GFP-CS2+
Plasmid#16787DepositorAvailable SinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits only