We narrowed to 42,374 results for: LAT
-
Plasmid#124786PurposeTemplate for C-terminal PCR tagging of mammalian genes (without selection) with mNeonGreenDepositorInsertmNeonGreen
UsePcr templateTagsmNeonGreenPromoterNoneAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
human p53-(1-360)
Plasmid#24865DepositorAvailable SinceAug. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
mpeg:lamp2-mCherry-stop; cmlc2:GFP
Plasmid#213740PurposeExpresses Lamp2-mCherry in the macrophage lineage of zebrafish with a green heart transgenesis markerDepositorInsertlamp2-mCherry
UseZebrafishPromotermpeg1.1Available SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
MRAS
Plasmid#55661Purposeexpression of mouse MRASDepositorAvailable SinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rif
Plasmid#23233DepositorAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDD121
Plasmid#91833PurposeCas9 expression in C. elegansDepositorInsertCas9
UseCRISPRExpressionWormMutationCodon optimized and with synthetic introns for C.…Available SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV5B-Flag-Par6 wt
Plasmid#11748DepositorAvailable SinceAug. 4, 2006AvailabilityIndustry, Academic Institutions, and Nonprofits -
lvl0-G-Gal4-VPR
Plasmid#229187Purposelvl 0 5 geneDepositorInsertGal4-VPR
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
YEp181-CUP1-His-Smt3
Plasmid#99536PurposeYeast episomal vector for expression of His-tagged Smt3 (SUMO); LEU2 markerDepositorAvailable SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-rSyntaxin-3a
Plasmid#195206PurposeMammalian expression vector for GFP tagged Syntaxin-3a.DepositorInsertSTX3A (Stx3 Rat)
ExpressionMammalianAvailable SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
H6-auxilin
Plasmid#62571Purpose6xHis-tagged full-length bovine brain auxilin (auxilin 1) in pQE30 for protein expression in bacteriaDepositorInsertAuxilin
Tags6XHisExpressionBacterialMutation*see comment belowAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJAT62
Plasmid#204301PurposeExpress phiC31 under control of D. melanoagaster vasa promoter, with Vasa 3’UTR.DepositorInsertie1-EGFP
UseCRISPRPromoterie1Available SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHA-PUMA DeltaBH3
Plasmid#16589DepositorAvailable SinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAd5-B6/7deltaE3
Plasmid#175748PurposeA block for the AdenoBuilder genome assembly system. The insert consolidates the regions present in pAd5-B6deltaE3 and pAd5-B7.DepositorInsertAdenovirus 5 genomic region 25043-35938
UseAdenoviral and Synthetic BiologyMutationAdenovirus sequences 27859-30803 replaced with Ba…Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
[pSK581] pRK5 HA-SLC38A9N
Plasmid#136141Purposemammalian expression of SLC38A9 N term fragment (1-119)DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
hSDH5
Plasmid#113046PurposeExpression of WT hSDH5DepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDB4282
Plasmid#98701PurposeA plasmid containing the 3' portion of the ura4 marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-ura4 systemDepositorInsertgRNA PCR template
UseCRISPRExpressionYeastAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-4493NES(Booster-PKA)
Plasmid#184709PurposePKA biosensorDepositorInsertBooster-PKA
ExpressionMammalianAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
B2088_BTB-IDR-FRB
Plasmid#215101PurposeExpresses BCL6 BTB(1-129)-mCherry-FUS (IDR)-FRB in mammalian cellsDepositorInsertBTB-mCherry-FUS(IDR)-FRB
ExpressionMammalianPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only