We narrowed to 13,275 results for: ache
-
Plasmid#204235PurposeBacterial expression of unicellular protozoan parasite P. falciparum malate dehydrogenase; Use in CURES (integration of research into undergraduate teaching labs).InsertMDH_PFALCI (PF3D7_0618500 Plasmodium falciparum)
Tags6X HisExpressionBacterialPromoterLacAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
TBXTA-c044
Plasmid#139767PurposeProtein expression/Streptavidin pull-downDepositorInsertTBXT, DNA-binding domain, G177D (TBXT Human)
TagsAvi-tag (Biotin) and His6-TEVExpressionBacterialMutationG177D; contains only amino acids E41- D225PromoterT7Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEx_Hsp70::attBmut
Plasmid#48878PurposePhiC31 exchange vector with the Hsp70 promoter driving tagRFPt from the landing site. Template for enhancer tests.DepositorTypeEmpty backboneAvailable SinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHH0103 APBB2 WW domain
Plasmid#104257PurposeBacterial expression of WW domain from APBB2DepositorInsertAPBB2 WW domain (APBB2 Human)
TagsGSTExpressionBacterialMutationcodon optimized for expression in bacteriaPromotertacAvailable SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muEDC-Int3
Plasmid#59288PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intronic region of the mouse Epidermal Differentiation Complex.DepositorInsertmFlg int-Intron 1
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pET24a MDH_HALMA
Plasmid#204241PurposeBacterial expression of H. marismortui (Dead Sea halophilic red archaeon) cytosolic malate dehydrogenase; Use in CURES (integration of research into undergraduate teaching labs).Available SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
TBXTA-c024
Plasmid#139761PurposeProtein expression/GST pull-downDepositorInsertTBXT, DNA-binding domain, G177D (TBXT Human)
TagsHis6-GST-TEVExpressionBacterialMutationG177D; contains only amino acids E41-D225PromoterT7Available SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR4
Plasmid#59273PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertIntergenic 3kb downstream Krt82
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR7
Plasmid#59276PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertintergenic 4kb upstream krt1
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR8
Plasmid#59277PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertIntergenic 2kb downstream krt79
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR1
Plasmid#59270PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertIntergenic 20kb downstream krt80
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muEDC-IGR15
Plasmid#59283PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the mouse Epidermal Differentiation Complex.DepositorInsertmLor-IGR2-3_nn79710
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR2
Plasmid#59271PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertIntergenic 10kb upstream krt80
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-huKC1-IGR19
Plasmid#59285PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the human keratin type I cluster.DepositorInsert9kb upstream hKrt14-1700
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR6
Plasmid#59275PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertintergenic 11kb upstream krt2
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR3
Plasmid#59272PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertIntergenic 4kb downstream Gm6042
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR11
Plasmid#59280PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertIntergenic 2kb upstream krt18
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJS101
Plasmid#118280PurposeExpresses GFPmut2 with low cell-to-cell variation on a low-copy plasmid and tetracycline inductionDepositorInsertGFPmut2
ExpressionBacterialPromoterpLtetO-1Available SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only