We narrowed to 12,675 results for: nsf
-
Plasmid#111743PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ25 (polyQ repeat)PromoterCMV and P10Available SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
78_pAAV-ProA27-CatCh-GFP-WPRE
Plasmid#125910PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA27Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
45_pAAV-ProC10-CatCh-GFP-WPRE
Plasmid#125945PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC10Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-FLPX-rc [ChrimsonR-GFP]
Plasmid#128588PurposeAAV-mediated expression of ChrimsonR-GFP under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterEF1α (1.1 kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBIG2ab_nsp14/nsp10-6His-3xFlag (SARS-CoV-2)
Plasmid#169164PurposeBaculoviral transfer vector to co-express SARS-CoV-2 nsp14 and nsp10 in insect cellsDepositorInsertnsp14/nsp10-6His-3xFlag (ORF1ab SARS-CoV-2, Synthetic)
Tags6His-3xFlag (nsp10 C-terminus)ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
193_pAAV-ProA35-CatCh-GFP-WPRE
Plasmid#125918PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA35Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
105_pAAV-ProC16-CatCh-GFP-WPRE
Plasmid#125951PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC16Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
194_pAAV-ProB15-CatCh-GFP-WPRE
Plasmid#125935PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB15Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
216_pAAV-ProD24-CatCh-GFP-WPRE
Plasmid#126000PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD24Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
27_pAAV-ProB12-CatCh-GFP-WPRE
Plasmid#125932PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB12Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-crRNA(SOD1)
Plasmid#109321PurposeAAV vector expressing crRNA for AsCpf1 (RR variant) targeting human SOD1DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
131_pAAV-ProB13-CatCh-GFP-WPRE
Plasmid#125933PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB13Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
55_pAAV-ProA13-CatCh-GFP-WPRE
Plasmid#125896PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA13Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
46_pAAV-ProC11-CatCh-GFP-WPRE
Plasmid#125946PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC11Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBIG1b_nsp7-Linker-nsp8 (SARS-CoV-2)
Plasmid#169181PurposeBaculoviral transfer vector to express untagged nsp7-Linker-nsp8 fusion protein (SARS-CoV-2) in insect cellsDepositorInsertnsp7-Linker-nsp8 (ORF1ab SARS-CoV-2, Synthetic)
TagsNo purification tag and nsp7-nsp8 fusion protein …ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
11_pAAV-ProC6-CatCh-GFP-WPRE
Plasmid#125942PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC6Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 rtTA BirA eIF4G
Plasmid#158789PurposepcDNA5 based transfection plasmid for the exogenous expression of N-terminal BirA-Flag-tagged eIF4G1 lacking the microexon for generation of N2A FlpIn cell lines for BioIDDepositorInserteIF4G1
Tags3xFlag and BirA*ExpressionMammalianPromoterminiCMVAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1270 - pAAV Rosa26 gRNA A+B EF1a EGFP
Plasmid#113156PurposeAn AAV vector that expresses guide RNAs targeting rat Rosa26 and expresses EGFP reporterDepositorInsertTwo gRNAs for rat Rosa26
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EHC
Plasmid#112619Purposeexpression plasmid with CAG promoter driving multicistronic cassette H2BEmerald_p2A_HygroR_p2A_CreERt2DepositorInsertsTagsVenusExpressionMammalianPromoterCAGAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only