We narrowed to 14,266 results for: crispr grnas
-
Plasmid#205982PurposeU6-MWEE01000013 Cas5-HNH DR-BpiI-DRDepositorInsertCas5-HNH DR-BpiI-DR
ExpressionMammalianPromoterU6Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgGFP-2
Plasmid#74961PurposeCas9 + sgGFP-2 with blasticidin selectionDepositorInsertGFP
UseCRISPRExpressionMammalianAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1-G7
Plasmid#173203PurposeExpresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.DepositorInsertATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQDKN0761
Plasmid#185630PurposeModified tobacco rattle virus RNA2 vector expressing an sgRNA fused to trucated flowering locus T which targets phytoene desaturase (PDS) of Nicotiana benthamiana, functionally equivalent to pEE393DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9N863Anickase.EF1a-BFP.sgLMNApair1
Plasmid#98976PurposeCas9 Homologous Recombination Reporter. SpCas9N863A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 44bp 3' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 1 and Cas9(N863A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 sgLacZ-1
Plasmid#74968PurposesgLacZ-1, puromycin selectionDepositorInsertLacZ
UseCRISPRExpressionMammalianAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 sgLacZ-2
Plasmid#74969PurposesgLacZ-2, puromycin selectionDepositorInsertLacZ
UseCRISPRExpressionMammalianAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pICSL11061
Plasmid#68255PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting BolC.GA4a-1 in Brassica oleraceaDepositorInsertPromoter_AtU6-26 + sgRNA_BolC.GA4a-1
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTW2278
Plasmid#252579PurposeTRV2 multiplex vector expressing wild type Ymu1, AtCHLl1 gRNA4 and AtPDS3 gRNA12DepositorInsertYmu1 with AtCHLl1 gRNA 4 and AtPDS3 gRNA12
UseCRISPRExpressionPlantAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTW2498
Plasmid#252581PurposeTRV2 multiplex vector expressing wild type Ymu1, AtCHLl1 gRNA6 and AtCHLl1 gRNA4DepositorInsertYmu1 with AtCHLl1 gRNA6 and gRNA 4
UseCRISPRExpressionPlantAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGuide-RUNX3
Plasmid#246659PurposeGuide RNA for human RUNX3DepositorInsertRUNX3 guide RNA (RUNX3 Human)
UseCRISPRAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-enCas9(D10A)-PolI5MΔ
Plasmid#249068PurposeExpresses nucleus-localized enCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertenCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(B)
Plasmid#236041PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideB3GNT5-neo
Plasmid#220867Purposeencodes CRISPR sgRNA targeting human B3GNT5DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviralAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2043-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9
Plasmid#223163Purpose2nd gen. AAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)Available SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-NS-A
Plasmid#207823PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGPromoterEF-1a; U6Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-NS-B
Plasmid#207824PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGPromoterEF-1a; U6Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH2 #7
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH1 #4
Plasmid#166101PurposeThis plasmid express a sgRNA that targets the IDH1 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH1-67 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only