We narrowed to 16,743 results for: grna
-
Plasmid#183314PurposeAll-in-One CRISPRko system with a guide RNA that targets PDGFRB geneDepositorInsertPDGFRB
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ144-ZmUbi-tRNA
Plasmid#158402PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ134-tRNA2.0; assembly of 4 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-lox-GFP shRNA p19-2
Plasmid#14091DepositorAvailable SinceFeb. 23, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shSmad4
Plasmid#37046DepositorAvailable SinceJan. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAV-shRNA-Tet2
Plasmid#85743PurposeshRNA against mouse Tet2DepositorInsertshRNA Tet2
UseAAVTagsEYFPAvailable SinceJune 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pABM-D4-miR30-CypA
Plasmid#132934PurposeLentivector for CypA knockdown and blasticidin resistanceDepositorInsertCypA shRNA
UseLentiviral and RNAiPromoterSFFVAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
p{CFD4-EYFP-3xP3::DsRed}
Plasmid#86863PurposeExpresses an EYFP gRNA ubiquitously and DsRed in eyes as a marker. With attB integration site.DepositorTypeEmpty backboneExpressionInsectAvailable SinceFeb. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRISPseq-mCherry-backbone
Plasmid#85708PurposeBackbone for CRISPR/Cas9 screening with single cell RNA-seq. Lentiviral plasmid for cloning of gRNAs and Unique Guide Index (UGI), with an mCherry fluorescent marker. Does NOT include Cas9.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGCP123-GFP_g1
Plasmid#153518PurposesgRNA to GFP gene (NT) under nisin-inducible nisA promoter, barcodedDepositorInsertPnisA-sgRNA(GFP_g1)_dCas9 scaffold (barcoded)
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TOP1
Plasmid#183323PurposeAll-in-One CRISPRko system with a guide RNA that targets TOP1 geneDepositorInsertTOP1
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPbU6_hdhfr/yfcu
Plasmid#216422PurposeEmpty backbone to express gene specific gRNA from the Plasmodium berghei U6 promoter for traditional CRISPR editing.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-sgHPDL #9
Plasmid#174166Purposeknock out HPDL in human cell linesDepositorInsertsgRNA against HPDL
UseLentiviralExpressionMammalianAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKEE401
Plasmid#91715PurposeCRISPR/Cas9-mediated genome editing in Arabidopsis. Contains Cas9 and empty gRNA scaffold, Kan resistanceDepositorTypeEmpty backboneExpressionPlantAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-tetO-CTR1-shRNA
Plasmid#53180PurposeExpresses shRNA against human CTR1 from puromycin resistance retroviral vectorDepositorAvailable SinceSept. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-phsyn-FLEX-KASH-EGFP-U6-shRNA
Plasmid#129708PurposeExpress cre-dependent KASH-EGFP and scramble shRNADepositorInsertKASH-EGFP
UseAAVTagsEGFPExpressionMammalianPromoterU6Available SinceAug. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FGFR3
Plasmid#183291PurposeAll-in-One CRISPRko system with a guide RNA that targets FGFR3 geneDepositorInsertFGFR3
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_AAVS1A
Plasmid#183337PurposeAll-in-One CRISPRko system with a guide RNA that targets the AAVS1 locusDepositorInsertAAVS1A
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT60
Plasmid#223432PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by 2x35s and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsert2x35s-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT61
Plasmid#223433PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-ZmUbi-gRNA scaffold 2.0-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only