We narrowed to 28,262 results for: SHR;
-
Plasmid#220190PurposesgRNA expression vector - pBG35 promoter with GFP in sgRNA siteDepositorInsertpBG35 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG35Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ESR1
Plasmid#183288PurposeAll-in-One CRISPRko system with a guide RNA that targets ESR1 geneDepositorInsertESR1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA-BSD
Plasmid#175583PurposeExpresses sgRNA for CasRx in mammalian cellDepositorInsertsgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TOP2B
Plasmid#183325PurposeAll-in-One CRISPRko system with a guide RNA that targets TOP2B geneDepositorInsertTOP2B
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRN227
Plasmid#127222PurposeBeYDV replicon with 35S::Cas9, WUS2 and AtSTM, sgRNA targeting PDSDepositorInsertCas9, WUS2, AtSTM, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA-CMV-GFP
Plasmid#85451PurposeExpress sgRNA in mammalian cellsDepositorInsertpCMV-EGFP
UseAAVPromoterpCMV-EGFPAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
LT3GEPIR
Plasmid#111177PurposeTet-ON miR-E (miR-30 variant)-based RNAiDepositorInsertmiR-E (miR-30 variant)
UseLentiviralMutationWTAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-EEA-g1-PGK-Puro
Plasmid#102908PurposePiggyBac transposon system construct for U6 promoter-driven expression of a gRNA targeting EEA-motif. Includes PGK-puro selection cassette.DepositorInsertEEA-guide1-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR: pmU6 sgChr3q29 2xMS2 pUbC MCP-mCherry-p2a-Puro
Plasmid#174118PurposeExpression of sgRNA targeting Chr3q29 (chr3: 195478317 - 195506985, hg38)DepositorInsertsgChr3q29 2xMS2 and MCP-mCherry-p2a-Puro
UseLentiviralPromotermU6 and UbCAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast
Plasmid#26655Purpose3rd gen lentiviral backbone for cloning and expression of new shRNA sequences. Uses blasticidin for selection.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral and RNAiExpressionMammalianAvailable SinceDec. 15, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDD428
Plasmid#202081PurposeCas9/sgRNA plasmid targeting the C-terminus of Myh9DepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFTK093
Plasmid#171365PurposeVector part (LVL1) from the Fungal Modular Cloning ToolKit.DepositorInsertsgRNA transcription unit (MoClo lvl1 unit), P-gpdA-HH-sgRNA-HDV-Ttrpc, replacable LacZ gene
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgAAVS1
Plasmid#184403PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1-specific sgRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-u6-gRNA(deltaD1)-hSyn-mCherry
Plasmid#231400PurposeKnockdown of DRD1 across rodent speciesDepositorInsertsgRNA(DRD1.2)
UseAAV and CRISPRExpressionMammalianPromoteru6Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-AAVS1
Plasmid#227272PurposeExpresses SpCas9 and a sgRNA targeting the AAVS1 loci for knock-in.DepositorAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGuide
Plasmid#64711PurposeCloning and expression of Streptococcus pyogenes guide RNADepositorInsertStreptococcus pyogenes guide RNA
UseCRISPRExpressionMammalianPromoterhU6Available SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCP-tRNA
Plasmid#133812PurposeCRISPR-Cas9 system for genetic manipulation of Candida parapsilosis, C. orthopsilosis, and C. metapsilosisDepositorInsertcassette for the expression of the sgRNA from the C. parapsilosis RNA pol II GAPDH promoter
UseCRISPRAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_TRAC
Plasmid#164993PurposeExpression of gRNA targeting TCRalpha constant locusDepositorInsertgRNA against TRAC
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
7a sgRNA for EJ7-GFP and 4-μHOM reporters
Plasmid#113620PurposesgRNA/CAS9 expression plasmid to induce the 5’ double-strand break in both the EJ7-GFP and 4-μHOM reportersDepositorInsert7a sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only