We narrowed to 3,492 results for: aaas
-
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos6_AmpR
Plasmid#119149PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanRDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR
UseCrisprAvailable SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
p104_gRNA_Sp_CD3e
Plasmid#213780PurposeExpresses CRISPRi gRNA for CD3e promoter and GFP. gRNA driven by mU6.DepositorInsertSp gRNA
UseCRISPR and LentiviralAvailable SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-USP10-CDS
Plasmid#136057PurposeUSP10 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTATGTGGAAACTAAGTATT)DepositorAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
p8267 LentiCRISPR v2 hygro sgNT-2
Plasmid#193978PurposeExpression of spCas9 and non-targeting control sgRNADepositorInsertspCas9
UseLentiviralAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
ZO-1 shRNA 2968
Plasmid#37208DepositorAvailable SinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
PX458_GABPA_1
Plasmid#64254PurposeExpresses gRNA against human GABPA along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
OgeuIscB ωRNA-v2
Plasmid#220958Purposehuman U6-driven expression of ωRNA-v2 scaffold with BsmBI for guide cloingDepositorInsertOgeuIscB-ωRNA-v2 scaffold with BsmBI for guide cloning
UseCRISPRExpressionMammalianAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLNL1126
Plasmid#160858PurposePJ23110-RBS-FaAAT2-mRuby2-tL3S2P24_KanR_p15ADepositorInsertAlcohol acyl transferase
UseSynthetic BiologyTagsmRuby2ExpressionBacterialPromoterPJ23110Available SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMH-25
Plasmid#158436PurposepBAD33 vector encoding MotA, YPet - 3 x EAAAK linker - MotBDepositorInsertsMotA
MotB
TagsyPET - 3 x EAAAK linkerExpressionBacterialAvailable SinceOct. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMH-05
Plasmid#158435PurposepBAD33 vector encoding MotA, YPet - EAAAK linker - MotBDepositorInsertsMotA
MotB
TagsyPET - EAAAK linkerExpressionBacterialAvailable SinceOct. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZBTB1_1
Plasmid#128242PurposeEncodes gRNA for 3' target of human ZBTB1DepositorInsertZBTB1 gRNA
UseCRISPRAvailable SinceNov. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCR3.1-OPNc M1
Plasmid#106321PurposeMammalian expression of mutant osteopontinDepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
OgeuIscB ωRNA-v13
Plasmid#219634Purposehuman U6-driven expression of OgeuIscB omegaRNA-v13 (ωRNA-v13) scaffold with BsmBI for guide cloningDepositorInsertOgeuIscB-ωRNA-v13 scaffold with BsmBI for guide cloning
UseCRISPRExpressionMammalianAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-H11r1-2-DD-Cas9
Plasmid#85978PurposeExpresses DD-SpCas9 in mammalian cells and targets the H11 locus in human cellsDepositorInsertDD-SpCas9
UseCRISPRTagsFKBP12 L106P DDExpressionMammalianAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_DDX4-cterm
Plasmid#222520PurposeCas9/sgRNA plasmid for targeting DDX4DepositorInsertCas9, DDX4 sgRNA (DDX4 Synthetic, Human)
UseCRISPRAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR-Zeo
Plasmid#158709PurposeFor cloning and constitutive expression of crRNAs in mycobacteriumDepositorInsertcrRNA
UseCRISPR and Synthetic Biology; Mycobacteria expres…ExpressionBacterialPromoterHsp60Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only