We narrowed to 1,931 results for: cas9 expression vector
-
Plasmid#78603PurposeAAV vector containing gRNAs (for SaCas9) targeting Dmd introns 22 and 23DepositorInsertU6-SaDMDR7-U6-SaDMDL2
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterU6Available sinceOct. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRN3P_T3_ABE8e_IVT
Plasmid#201676PurposePlasmid to be used as DNA template for in vitro RNA transcription of the ABE8e base editor (A to G) by T3 RNA polymerase. The plasmid contains optimised 5'UTR and 3'UTR to improve protein expression.DepositorInsertecTadA(8e)-nSpCas9
UseCRISPR; Vector for in-vitro transcriptionTagsExpressionMutationPromoterT3 promoterAvailable sinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF142_U6-sgRNA
Plasmid#225960PurposeU6-sgRNA (recipient). Expresses U6-sgRNA (recipient) for VLP production. This is a recipient vector for cloning of specific SpyCas9 sgRNAs.DepositorInsertU6-sgRNA (recipient)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMVP and pMAGIC Cloning Systems
Plasmid Kit#1000000155PurposepMVP and pMAGIC are cloning systems for adenoviral, lentiviral, expression, PiggyBac transposon, and Sleeping Beauty transposon vectors for transgene or RNAi delivery and dCas9-based engineering.DepositorAvailable sinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iSAM
Plasmid#211495PurposeAAVS1 targeting vector containing an all-in-one DOX-inducible system for CRISPRaDepositorInsertsUniSAM insert
TET-ON
Neo Resistance
Insulator
UseCRISPR and Synthetic BiologyTagsT2A-mCherry TagExpressionMammalianMutationPromoterEF1a, NA, Splicing acceptor, and TREGV promoterAvailable sinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_RB1#2
Plasmid#174151PurposeLentiviral vector expressing Cas9 and a sgRNA against the human RB1 geneDepositorInsertRB1 (RB1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
lenti.DTR.GFP
Plasmid#201962PurposeLentiviral vector that expresses diptheria toxin receptor (DTR) C-terminally fused to EGFPDepositorInsertDiptheria Toxin Receptor
UseLentiviralTagsEGFPExpressionMammalianMutationPromoterEF1alphaAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRP_8xgRNA-FLuc
Plasmid#135937PurposeFirefly luciferase reporter containing 8 copies of a gRNA binding site for light-inducible dCas9 activation.DepositorInsert8 copies of gRNA binding site (5'-AAAGGTCGAGAAACTGCAAA-3')
UseLuciferaseTagsExpressionMammalianMutationPromoterminCMVAvailable sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only