We narrowed to 4,689 results for: GCA
-
Plasmid#206357PurposeAAV plasmid expressing HSP90AB1 shRNA in photoreceptorsDepositorInsertshRNA #a of Hsp90ab1
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
E42_gControl_dTet_IRES_mTurquoise2
Plasmid#189799PurposeRetroviral delivery of control guide RNADepositorInsertLuciferase gRNA
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ssh2 gRNA#3
Plasmid#163399PurposeCas9-mediated knockout of Ssh2 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-2
Plasmid#164859PurposeConstitutive expression of single-spacer CRISPR array with spacer #2 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-2
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-2
Plasmid#164866PurposeConstitutive expression of single-spacer CRISPR array with spacer #2 targeting deGFP mRNA for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-2
UseCRISPRExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-3'UTR
Plasmid#136042PurposeUPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-CDS
Plasmid#136043PurposeUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
EMX1*_sgRNA
Plasmid#100558PurposeExpresses EMX1* sgRNA. Target sequence: (G)GAGTCCGAGCAGAAGAAGAA. Same target sequence as #100555, except with an additional 5' G.DepositorInsertEMX1 sgRNA
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF792_1
Plasmid#86339PurposeEncodes gRNA for 3' target of human ZNF792DepositorInsertgRNA against ZNF792 (ZNF792 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-VR
Plasmid#62286Purposeexpression of VR sgRNA from the arabinose-inducible promoterDepositorInsertVR sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
MsMUT_sgRNA1
Plasmid#111296PurposeCRISPR KO murine MUTDepositorInsertsgRNA1 against murine MUT
UseCRISPR and LentiviralExpressionMammalianAvailabilityAcademic Institutions and Nonprofits only -
pAAV.GfaABC1D.PI.Lck-GFP.SV40
Plasmid#105598PurposeAAV expression of membrane bound EGFP from GfaABC1D promoterDepositorHas ServiceAAV5InsertLck-EGFP
UseAAVExpressionMammalianPromoterGfaABC1DAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
QPM-sgR (pTaU3)
Plasmid#140448PurposeFor sgRNA expression in monocotyledons protoplastsDepositorInsertTaU3-sgRNA
UseCRISPRExpressionPlantPromoterTaU3Available SinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shBRCA1 #2
Plasmid#44595DepositorAvailable SinceMay 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pU6-PspCas13b-GEMSgRNA2
Plasmid#204768PurposepU6-PspCas13b-gRNA-Actb1216 backbone (Addgene ID: 155368) containing guide RNA #2 targeting the GEMS m6A reporter mRNA sequence.DepositorInsertguide RNA targeting GEMS m6A sensor mRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBa.Lamp1-GFP
Plasmid#180250PurposeMammalian expression of LAMP1DepositorAvailable SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
7b sgRNA for EJ7-GFP reporter
Plasmid#113624PurposesgRNA/CAS9 expression plasmid to induce the 3’ double-strand break in the EJ7-GFP reporterDepositorInsert7b sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKL002
Plasmid#98921PurposepET DUET backbone with PROPS voltage indicator and GCaMP6f calcium sensor in the two MCS.DepositorInsertsPROPS
GCaMP6f
ExpressionBacterialPromoterT7Available SinceAug. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
7h sgRNA for 4-μHOM reporter
Plasmid#113625PurposesgRNA/CAS9 expression plasmid to induce a 3’ double-strand break in the 4-μHOM reporter at the edge of the microhomology.DepositorInsert7h sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgRNA 2 GAPDH
Plasmid#83809PurposeExpress Sg-2 sgRNA targeting GAPDHDepositorInsertSgRNA
UseCRISPRAvailable SinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits only