We narrowed to 16,626 results for: grna
-
Plasmid#90990PurposeNAT-marked C. albicans ADE2-specific gRNA expression construct; part 2 of 2 of C.mal LEUpOUT CRISPR system. Use with pADH140 CAS9 expression construct.DepositorInsertNAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, C. maltosa LEU2 2 of 2
UseCRISPRAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Gly-tRNA-gRNA scaffold for library 2
Plasmid#192365PurposetRNA sequence provider (for checkpoint library)DepositorInsertGly tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable sinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pro-tRNA-gRNA scaffold for library 2
Plasmid#192366PurposetRNA sequence provider (for checkpoint library)DepositorInsertPro tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable sinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gln-tRNA-gRNA scaffold for library 1&2
Plasmid#192367PurposetRNA sequence provider (for checkpoint and immune library)DepositorInsertGln tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable sinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gly-tRNA-gRNA scaffold for library 1
Plasmid#192368PurposetRNA sequence provider (for immune library)DepositorInsertGly tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable sinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pro-tRNA-gRNA scaffold for library 1
Plasmid#192369PurposetRNA sequence provider (for immune library)DepositorInsertPro tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable sinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
MTF2_KO_ex11_gRNA-4
Plasmid#131334PurposegRNA to knockout MTF2. This gRNA is also used in Haojie Li et al. Nature 2017. It targets exon 11 of MTF2.DepositorInsertMTF2_KO_ex11_gRNA
UseCRISPRExpressionMammalianAvailable sinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-EN1201
Plasmid#92144PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse TIGRE acceptor locusDepositorInsertspCas9-nuclease and sgRNA against mouse TIGRE acceptor locus
ExpressionMammalianAvailable sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
gRNA_SRR134.3_miRFP670
Plasmid#163754PurposegRNA expression vector containing the miRFP670 fluorescent marker to target the region downstream of the SRR134 SOX2 enhancer in human cells.DepositorInsertgRNA_SRR134.3
UseCRISPRTagsmiRFP670ExpressionMammalianPromoterU6Available sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR1323
Plasmid#111125PurposeExpresses non-targeting_01224 sgRNA in pCR1068DepositorInsertNon-targeting gRNA
UseLentiviralAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-
pYPQ144
Plasmid#69296PurposeGolden Gate recipient and Gateway entry vector; assembly of 4 gRNAsDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX458_AHR_2
Plasmid#101077PurposeEncodes gRNA for 3' target of human AHRDepositorPublicationInsertgRNA against AHR (AHR Human)
UseCRISPRAvailable sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-RB1
Plasmid#87836PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive expression of an sgRNA targeting human RB1.DepositorInsertsgRB1 (RB1 Human)
UseCRISPR and Lentiviral; Doxycycline inducible; egf…ExpressionMammalianPromoterTight TRE promoter and U6Available sinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKCcas9dO
Plasmid#62552PurposeHigh efficiency Streptomyces genome editing by CRISPR/Cas9 systemDepositorInsertsScocas9
sgRNA ()
act-orf4 homology arm
UseCRISPR; Bacterial genome editingExpressionBacterialPromoterj23119 and ptipAAvailable sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSB700-TTN-Puro
Plasmid#128323PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (human cells)DepositorInsertgRNA against human TTN for activation
ExpressionMammalianAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDG335
Plasmid#100899PurposeSpCas9n (D10A Nickase mutant) with a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTagsHAExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available sinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC365
Plasmid#91214Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (CmYLCV promoter, tRNA processing)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
BRCA1 A10.2 gRNA
Plasmid#90549Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA1DepositorInsertBRCA1 (Guide Designation A10.2)
UseCRISPR and LentiviralPromoterU6Available sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only