We narrowed to 41,781 results for: LAT;
-
Plasmid#27136DepositorUseLentiviralTagseGFP and mCherryExpressionMammalianMutationArginines in the SH2 domains mutated to lysines (…Available SinceApril 12, 2011AvailabilityAcademic Institutions and Nonprofits only
-
pOTTC710 - pAAV EF1a DIO Mem-AcGFP
Plasmid#75081PurposeAn AAV packaging vector that expresses Cre-dependent membrane-localized AcGFP under control of the EF1a promoter.DepositorInsertMem-AcGFP
UseAAV and Cre/LoxTagsPalmitylation siteExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHR-ZIP(FF)
Plasmid#27135DepositorUseLentiviralTagseGFP and mCherryExpressionMammalianMutationTyrosines in ITAMS 1-3 mutated to phenylalanines …Available SinceApril 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-RASA1-3'UTR
Plasmid#62575PurposeTranslational Luciferase Reporter containing a 926 bp fragment of the RASA1 3'UTR.DepositorAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSRG11 (eft-3p::scfv(glo)::gfp(smu-1 introns)::tbb-2 3’UTR)
Plasmid#245121PurposeOptimized SunTag antibody for expression in C. elegans. Useful for visualization of translation of GCN4 encoding mRNAs or for visualization of GCN4-tagged proteinsDepositorInsertseft-3p
scFv (GLO)
GFP (GLO)
tbb-2 3'UTR
left recombination arm MosSCI ttTi5605
right recombination arm MosSCI ttTi5605
ExpressionBacterial and WormAvailable SinceJan. 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD S1859E
Plasmid#169822PurposeExpresses C-terminal flag-tagged CAD with mutation of reported S6K phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationS1859E; TCCC -> AGTC silent mutations at nt527…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-CBP(1603-2678)
Plasmid#183774PurposeExpress GST-CBP(1603-2678) in E. coli. Purified GST-CBP(1603-2678) was used for in vitro acetylation assays.DepositorAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD T456A S1406A S1859A
Plasmid#169826PurposeExpresses C-terminal flag-tagged CAD with mutation of reported S6K, PKA, and Erk1/2 phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationT456A S1406A S1859A; TCCC -> AGTC silent mutat…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD T456A S1406A
Plasmid#169823PurposeExpresses C-terminal flag-tagged CAD with mutation of reported Erk1/2 and PKA phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationT456A S1406A; TCCC -> AGTC silent mutations at…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD T456A S1859A
Plasmid#169824PurposeExpresses C-terminal flag-tagged CAD with mutation of reported Erk1/2 and S6K phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationT456A S1859A; TCCC -> AGTC silent mutations at…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV1.X1
Plasmid#209780Purposenon-standard AAV2 rep-AAV1-X1 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV1-X1 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV9-X1.1
Plasmid#196836Purposenon-standard AAV2 rep-AAV9-X1.1 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV9-X1.1 VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDCAF3-IS5
Plasmid#65220PurposeExpresses N-demethylases for the degredation of caffeine and related methylxanthines. Can be used to measure caffeine content as described in the publication listed below.DepositorInsertsndmA
ndmB
ndmC
ndmD
gst9
chlR
UseSynthetic BiologyExpressionBacterialMutationChanged start codon from gtg to atg and Changed s…PromoterBBa_J23100Available SinceJan. 8, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only