We narrowed to 6,255 results for: tTA
-
Plasmid#234547Purposeto express the optogenetic tool 2pabPAC, which increases cAMP levels when stimulated by blue light, in astrocytesDepositorInsert2pabPAC
UseAAVMutationNonePromotermGFAP(ABC1D)Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-12mer-14kb-USF-1-12
Plasmid#227472Purpose12-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH020 sgControl (GEA)
Plasmid#228193PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD 11W D262V
Plasmid#234618PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) D262V with partial W mutantDepositorInserthnRNPA1_LCD_11W D262V (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationF202W, F210W, F216W, F222W, F228W, Y237W, Y244W, …PromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_hnRNPA1_YtoW
Plasmid#224253PurposeBacterial expression of N-terminally 6His-tagged hnRNPA1_YtoWDepositorInserthnRNPA1_YtoW (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationY52W, Y59W, Y75W, Y81W, Y110W, Y120W, Y129WPromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon5
Plasmid#177763PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon8
Plasmid#177764PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgZmat3.52.6/Cre
Plasmid#167854PurposeExpresses Cre recombinase and an sgRNA targeting Zmat3DepositorInsertsgRNA targeting Zmat3
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_2
Plasmid#155066PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro (PX459)+gRNA miR-124-3-5'
Plasmid#117323PurposeCRISPR-Cas9 for miR-124-3, 5'DepositorAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-HSPE-sh1
Plasmid#92033PurposepSIREN-RetroQ vector containing shRNA sequence to HPSEDepositorInsertshRNA #1 to HPSE (Hpse Mouse)
UseRetroviralAvailable SinceJuly 19, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
A1-LCD WT
Plasmid#169713PurposeBacterial expression of human hnRNPA1-A Low complexity domain including amino acids 186-320DepositorInserthnRNPA1 (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available SinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG) matched positive control in pTwist-CMV
Plasmid#216156PurposeExpresses mScarlet regardless of TDP-43 knockdown. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmScarlet with C-terminal FLAG tag
ExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-EBF1
Plasmid#96965PurposeDox-inducible expression of Ebf1 in mammalian cellsDepositorAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
loxP-G418-LoxP-TurboID-Rab11 HR
Plasmid#230026PurposeHomology repair plasmid for endogenous tagging of Rab11 at the N-terminus with TurboID and a V5 epitope tag. Contains a G418 resistance cassette for selection of edited cellsDepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-3XHA-p53
Plasmid#196267PurposeMammalian expression of 3xHA tagged wild-type p53DepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-GSX2
Plasmid#96964PurposeDox-inducible expression of Gsx2 in mammalian cellsDepositorInsertGSX2 (Gsx2 Mouse)
ExpressionMammalianAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PL-5LTR-RGR(DMD#1)-AmCyan-A
Plasmid#138482PurposeExpresses sgRNA targeting human DMD (Dystrophin) for packaging into NanoMEDIC particle.DepositorInsertRibozyme-flanked gRNA and AmCyan
UseCRISPRExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-MAPK14
Plasmid#200973Purposea mammalian expression vector to express MAPK14DepositorInsertmitogen-activated protein kinase 14 (MAPK14) (MAPK14 Human)
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only