We narrowed to 13,537 results for: BASE
-
Plasmid#227422Purposeexpresses the C-terminal of AAV-NG-CBEDepositorInsertAAV-NG-CBE C-terminal
UseAAV and CRISPRExpressionMammalianPromoterCbhAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-8x
Plasmid#172284PurposeExpressing EGFP mRNA fused with 8 tandem repeats of a 50-base sequenceDepositorInsertEGFP-N1-8x
ExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNH12 (pmyo-2::MacQ::mCitrine)
Plasmid#130274PurposeExpresses the eFRET-based voltage sensor MacQ::mCitrine in the pharynx of C. elegans.DepositorInsertMacQ::mCitrine
TagsmCitrineExpressionWormAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
ABEMax nSaCas9
Plasmid#135364PurposeExpresion of SaCas9 nickase (D10A) with ABEMax at the N terminusDepositorInsertABEMax nSaCas9
UseCRISPRExpressionMammalianMutation(V82G)Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-evoA1-seBEN_empty
Plasmid#174701PurposeSmall-molecule controlled base editingDepositorInsertLenti-evoA1-seBEN
UseLentiviralTagsmyc tagPromoterEFS/U6Available SinceNov. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-evoA1-seBEC
Plasmid#174702PurposeSmall-molecule controlled base editingDepositorInsertLenti-evoA1-seBEC
UseLentiviralTagsflag tagMutationUGI-E11KPromoterEFSAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
CNNM3-CBS-YPet
Plasmid#149686PurposeFor the FRET-based binding assay between human CNNM3 CBS domain and PRL2.DepositorInsertCNNM3-CBS-YPet (CNNM3 Human, Synthetic)
Tags8 histidine tagExpressionBacterialPromoterT7Available SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFBP-4_1.sensor
Plasmid#162844PurposeYeast expression of the RNA-based sensor for fructose-1,6-bisphosphate #4_1DepositorInsert4_1_RNA-device
ExpressionYeastAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFBP-4_1m.mutant
Plasmid#162869PurposeYeast expression of the mutant #4_1m for the RNA-based sensor of fructose-1,6-bisphosphate #4_1DepositorInsert4_1m_RNA-device
ExpressionYeastAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-2x
Plasmid#172282PurposeExpressing EGFP mRNA fused with 2 tandem repeats of a 50-base sequenceDepositorInsertEGFP-N1-2x
ExpressionMammalianPromoterCMVAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-4x
Plasmid#172283PurposeExpressing EGFP mRNA fused with 4 tandem repeats of a 50-base sequenceDepositorInsertEGFP-N1-4x
ExpressionMammalianPromoterCMVAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_Tuba1b sgRNA / hSpCas9
Plasmid#172835PurposeMammalian expression of a sgRNA targeting the intron 1 of Tuba1b (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Tuba1b under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJY-RpABE-FT_INF
Plasmid#112874Purposebinary vector for INF (Induced Neo-Functionalization) of FT in ArabidopsisDepositorInsertsRPS5A promoter
ABE7.10
U6-sgRNA targeting FT
UseCRISPRExpressionPlantAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
MyoUTipGAPi
Plasmid#127549PurposePositive RNAi control for pGAPi-based RNAi silencing in tandem with APT transcript segmentDepositorInsertMyosin XIa+b 5'UTR and Adenine Phosphorybosyltransferase transcript segment
UseRNAi; Positive controlPromoterUbiquitinAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eBE-S1
Plasmid#101092PurposeExpresses eBE-S1 in mammalian cellsDepositorInserteBE-S1
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN_TmiR_G13-L
Plasmid#25762PurposeEntry vector with TRE promoter driving mouse G alpha 13 miR30-based shRNA.DepositorInsertG alpha 13 miR-shRNA
UseGateway CloningAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34
Plasmid#247209PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34∆RBS
Plasmid#247213PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only