We narrowed to 12,355 results for: HAL;
-
Plasmid#244807PurposeModified plasmid from pADH99 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertCauHIS1_US
UseCRISPRTagsC. albicans MAL2 promoter, C. albicans codon opti…ExpressionYeastAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA3
Plasmid#166909PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
pHD57 [Tol2-UAS:sypb-egfp-cry2-polyA]
Plasmid#198381PurposeExpression of SYPB::CRY2olig(535) in neurons of Danio rerioDepositorInsertUAS:sypb-egfp-cry2
UseTol2TagsEGFPMutationD387APromoterUASAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
MuHKI-pGFPN3
Plasmid#21919DepositorInsertMutant huamn HKI (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK1 Human)
TagsGFPExpressionMammalianMutationThis is the full length human HKI cDNA sequence w…Available SinceNov. 2, 2009AvailabilityAcademic Institutions and Nonprofits only -
ATG-1929
Plasmid#108712PurposeCBR2opt in pF4Ag expression vector with T7 and CMV promoterDepositorInsertCBR2opt
ExpressionBacterial and MammalianMutationPromega used directed evolution to create CBR (Cl…PromoterT7, CMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
sh-SRF
Plasmid#100797Purposeexpression of shRNA targeting SRFDepositorInsertrat SRF
UseRNAiPromoterH1Available SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIRESN2 H2B-GFP-uvr8at(2x)
Plasmid#44970DepositorTagsinternal GFPExpressionMammalianMutationtandem repeat of UVR8 (both have Methionine 1 del…PromoterpCMV IEAvailable SinceJune 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA1
Plasmid#166889PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAB17 (punc-17::QuasAr)
Plasmid#214888PurposeExpresses the voltage sensor QuasAr2 in cholinergic neurons of C. elegans.DepositorInsertQuasAr2
ExpressionWormAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-SRRD-mRuby3
Plasmid#214920Purposeinducible expression of SRRD tagged on C-terminus with mRuby3DepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-noTag (in pLEX_307)
Plasmid#214919Purposeconstitutive expression of SRRD with no tag - used as control for SRRD-HA expressionDepositorInsertSRRD (SRRD Human)
UseLentiviralAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-HA (in pLEX_307)
Plasmid#214918Purposeconstitutive expression of SRRD tagged with HADepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEE071
Plasmid#176828PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert710
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEE073
Plasmid#176830PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert712
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEE074
Plasmid#176831PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert713
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
VV017: Archaerhodopsin-3 w/ D95Q point mutation fused to eGFP
Plasmid#58490PurposeExpresses Arch(D95Q)-eGFP in mammalian cells as a fluorescent reporter of membrane voltageDepositorInsertArchaerhodopsin-3 w/ D95H point mutation fused to eGFP
UseLentiviralTagseGFPExpressionMammalianMutationChanged Aspartic Acid 95 to GlutaminePromoterUbiquitinAvailable SinceAug. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
ATG-2460
Plasmid#108713PurposeEF1-CBR2opt-T2A-copGFP (construct used for lentiviral transduction)DepositorInsertCBR2opt-copGFP fusion
UseLentiviralTagsCBR2opt fused to copGFPMutationPromega used directed evolution to create CBR (Cl…Promoterelongation factor-1Available SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only