We narrowed to 37,393 results for: tat
-
Plasmid#31272DepositorInsertNkx2-1* (Nkx2-1 Mouse)
UseRetroviralTagsExpressionMammalianMutationA shNkx2-1 insensitive Nkx2-1 cDNA was created by…PromoterAvailable sinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pESC-LEU-HsAIDSc
Plasmid#60810Purposeto express human AID recoded for yeast codon usageDepositorInsertAID (AICDA Human)
UseTagsMycExpressionYeastMutationcodon optimized for yeastPromoterGAL1Available sinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
aL-L3
Plasmid#103881Purposefull-length human aL with moxsynGFP in betapropellerDepositorInsertfull-length human aL with moxsynGFP in betapropeller (ITGAL Human)
UseTagstension sensor moduleExpressionMutationPromoterAvailable sinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMCP-MU-Luc (MCP-1 mut promoter in pGL3-basic)
Plasmid#40325DepositorInsertMCP-1 promoter (mutated) (Ccl2 Mouse)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationcontains MCP-1 promoter region through the nucleo…PromoterMCP-1Available sinceOct. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-XL4 ASXL1 (p.R404X) 3x FLAG
Plasmid#74263PurposeCancer-associated ASXL1 truncation mutant in mammalian expression vectorDepositorInsertASXL1 (ASXL1 Human)
UseTags3X FLAGExpressionMammalianMutationp.R404X truncationPromoterCMVAvailable sinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRN3P-HA-Suv4-20h1mut
Plasmid#86690PurposeFor transcription of of Suv4-20h1mut mRNA preceded by an HA-tag in 5'DepositorInserthistone-lysine N-methyltransferase KMT5B mutant (Kmt5b Mouse)
UseTagsHAExpressionMutationmutated region NHDC (asparagine 273 to cysteine 2…PromoterT3Available sinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRAF_S29A_pcDNA3.1
Plasmid#86506PurposeExpresses CRAF_S29A in mammalian cells [Edit]DepositorInsertCRAF (RAF1 Human)
UseTagsFLAGExpressionMammalianMutationS29APromoterCMVAvailable sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-NoStart
Plasmid#49853PurposeEncodes human connexin 43 with the start methionine codon mutated to isoleucine and with wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
UseTagsExpressionMammalianMutationStart codon mutated to from methionine to isoleuc…PromoterCMVAvailable sinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
xCIAR_pcDNA5/FRT/TO
Plasmid#86504PurposeExpresses inactive control CIAR (xCIAR) in mammalian cells. Used to generate Flp-In stables.DepositorInsertxCIAR (SOS1 Human)
UseFrtTagsExpressionMammalianMutationF929A and T968L in SOScatPromoterCMV (tet operator)Available sinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-M100L-siResist
Plasmid#49854PurposeEncodes human connexin 43 with M100 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
UseTagsExpressionMammalianMutationMethionine100 mutated to Leucine. Contains severa…PromoterCMVAvailable sinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDF1-ADAM29 (E111K)
Plasmid#31144DepositorInsertADAM29 (ADAM29 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationGlutamic acid 111 changed to LysinePromoterAvailable sinceSept. 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
DBDmut-CA-RIT-NFAT1
Plasmid#63669PurposeConstitutively active NFAT1 and also unable to interact with AP-1 with four point mutations in the DNA binding loop that abolish DNA bindingDepositorInsertNFAT1 (Nfatc2 Mouse)
UseRetroviralTags3x HAExpressionMammalianMutationCA: PASSGSSASF mutated to PAAAGAAAAF, SPRTSPIMSP…PromoterAvailable sinceJuly 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAM-DCA-HA-Ast-3-NP-1-IRES-mCherry-WPRE
Plasmid#159630PurposeAAV expression of HA Allatostatin-3, neurophysin, IRES mCherry under the CAG promoterDepositorInsertAst (AstA Fly)
UseAAVTagsHA, IRES, mCherry, and neurophysin-1ExpressionMammalianMutationPromoterDCA (same as CAG promoter)Available sinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLY54
Plasmid#130923PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA2B2 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA2B2, and PtetAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCSC-CMV-HA-Ast-3-NP-1-IRES-mCherry
Plasmid#159631Purposeexpresses HA Allatostatin-3, Neurophysin-1, IRES mCherry under the CSC promoterDepositorInsertAst (AstA Fly)
UseLentiviralTagsHA, IRES, mCherry, and neurophysin-1ExpressionMammalianMutationPromoterCMV promoterAvailable sinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLY9
Plasmid#130907PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-2G6 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-2G6, and PtetAvailable sinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY59
Plasmid#130927PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::MCP controlled by promoter J23106), and the reporter part (PpspA-2G6 with sfgfp::ASV).DepositorInsertsdcas9
tetR
sfgfp
pspFΔHTH::MCP
UseSynthetic BiologyTagsASV tag and MCP (MS2 coat protein)ExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-2G6, and PtetAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY57
Plasmid#130926PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA5B5 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA5B5, and PtetAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only