We narrowed to 4,666 results for: gca
-
Plasmid#174303PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #3 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-mGreenLantern/EGFP
Plasmid#188482PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Ski-gRNA1
Plasmid#180368Purposetargeting mouse Ski geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_EBFP_Nick_Dual_sgRNA
Plasmid#178094PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and EBFP Nick sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + EBFP nick sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop C
Plasmid#171781PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Asp173 and Gly174DepositorInsertsfGFP-DogTag Loop C
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Asp1…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-SpyTag003 Loop B
Plasmid#171777PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Asp102 and Asp103DepositorInsertsfGFP-SpyTag003 Loop B
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues A…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-SpyTag003 Loop C
Plasmid#171778PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Asp173 and Gly174DepositorInsertsfGFP-SpyTag003 Loop C
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues A…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
p3E-U6a-U6c-opa1 guide
Plasmid#121995PurposeAn entry vector with U6a and U6c promoter driving opa1 guide RNAs expressionDepositorInsertopa1 gRNA
UseCRISPRAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
pSC39
Plasmid#104813PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g101180 (Cop-like). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr2g101180
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC24
Plasmid#104798PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g101120, Medtr2g101130 (Acre2). Also expresses Cas9 from rolD promoter from AtUBQ10 promoterDepositorInsertMedtr2g101120, Medtr2g101130
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-shEsr1
Plasmid#120720PurposeLentiviral vector that expresses GFP and an shRNA targeting Esr1 (in pLL3.7).DepositorInsertEsr1 shRNA (Esr1 Mouse)
UseLentiviral and RNAiTagsGFPExpressionMammalianPromoterMouse U6Available SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
eGFP-SUN1ΔN
Plasmid#213508PurposeExpresses human eGFP-SUNΔN in mammalian cellsDepositorInserteGFP-SUNΔN
ExpressionMammalianMutationSUN1ΔN has the first 138 amino acid (lamina domai…PromoterCMVAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTol1-U6abc_ect2_cmlc2-nmKate
Plasmid#238410PurposeDrives expression of 3 different gRNAs targeting ect2, and expression of nuclear mKate in cardiomyocytesDepositorInsertnuclear mKate/3 gRNAs targeting ect2
Promotercmlc2 (nmKate); U6 (gRNAs)Available SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol1-U6abc_cmlc2(myl7)_cmlc2-nmKate
Plasmid#238374PurposeDrives expression of 3 different gRNAs targeting cmlc2 (myl7), and expression of nuclear mKate in cardiomyocytes.DepositorInsertnuclear mKate/3 gRNAs targeting cmlc2
Promotercmlc2 (nmKate); U6 (gRNAs)Available SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGPTVII-Bar-U-MatryoshCaMP6s
Plasmid#100024PurposePlant expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference Large Stokes Shift (LSS) mOrange nested within the reporting cpEGFP.DepositorInsertMatryoshCaMP6s
ExpressionPlantPromoterAtUBQ10Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST
Plasmid#125689PurposeC to T base editor for actinomycetesDepositorInsertstreptomyces codon optimized spCas9n (D10A), modified sgRNA casette, streptomyces codon optimized rAPOBEC1
UseCRISPR and Synthetic BiologyPromoterermE*/tipAAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only