We narrowed to 3,315 results for: cgas
-
Plasmid#68428PurposeTransient expression in mammalian cells of an "INT" construct_bearing the GFP aptamer, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing the GFP aptamer
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterhuman U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3NT
Plasmid#62259Purposeexpression of A3NT sgRNA from the arabinose-inducible promoterDepositorInsertA3NT sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[3xK-T]
Plasmid#68429PurposeTransient expression in mammalian cells of an "INT" construct_bearing three kink-turns, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing three kink-turns
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterhuman U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14107 fwYellow-targeting sgRNA
Plasmid#239456Purposeguide for fwYellowDepositorInsertguide targeting fwYellow
UseCRISPR; Cell-free system using bacterial extractTagsExpressionBacterialMutationPromoterJ23119Available sinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp4
Plasmid#238037PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp2
Plasmid#238035PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp3
Plasmid#238036PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp6
Plasmid#238039PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp5
Plasmid#238038PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbPDS
Plasmid#231147PurposeT-DNA encoding TRV2 with mobile gRNA targeting NbPDSDepositorInsertmobile gRNA targeting NbPDS
UseTagsExpressionPlantMutationPromoterPEBV sub-genomicAvailable sinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA_SRR134.3_miRFP670
Plasmid#163754PurposegRNA expression vector containing the miRFP670 fluorescent marker to target the region downstream of the SRR134 SOX2 enhancer in human cells.DepositorInsertgRNA_SRR134.3
UseCRISPRTagsmiRFP670ExpressionMammalianMutationPromoterU6Available sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…TagsExpressionMammalianMutationPromoterGACG and U6.3 chickAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g1 LentiCRISPRv2-mCherry
Plasmid#218662PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorInsertGOLIM4 (GOLIM4 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xMS2 TR knockin sgRNA 1
Plasmid#207607PurposesgRNA for homology directed repair insertion of 3xMS2-TR-100-PURO into the endogenous TR locusDepositorInsertcgactcgcccggcagcgcac
UseTagsNoneExpressionMammalianMutationPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
LV-sgRNA-mCherry-Puro sgPIDD
Plasmid#211528PurposeDeletes PIDDDepositorInsertsgPIDD
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Merry Target 3- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210743PurposeCoding for SaSp Cas9 alongside Merry sgRNA targeting GFP Target 3DepositorInsertsSaSp Cas9
Merry sgRNA GFP Target 3
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 3- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210739PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 3DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationPromoterH1 and eCMVAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 1- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210737PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 1DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationPromoterH1 and eCMVAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 4- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210748PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 4DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 4
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Merry Target 1- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210741PurposeCoding for SaSp Cas9 alongside Merry sgRNA targeting GFP Target 1DepositorInsertsSaSp Cas9
Merry sgRNA GFP Target 1
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only