-
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLJM60-FLAG-SLC38A9.1 Y71A
Plasmid#71865Purposelentiviral stable expressionDepositorInsertSLC38A9.1 (SLC38A9 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationcodon optimized, Tyrosine 71 mutated to AlaninePromoterCMVAvailable sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKM-U6-reRNA-hsHEKsite_1_3
Plasmid#205638PurposereRNA guide targeting HEKsite_1_3DepositorInsertreRNA-HEKsite_1_3 (EPHA3 Human)
UseTagsExpressionMammalianMutationPromoterU6Available sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-HA-ER Y537S
Plasmid#49499PurposeExpresses HA-tagged ER Y537S mutant in mammalian cellsDepositorInsertESR1 (ESR1 Human)
UseTagsHAExpressionMammalianMutationTyrosine 537 to SerinePromoterCMVAvailable sinceDec. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T1-ISG15 C78SN13Y
Plasmid#165106Purposebacterial expressio of a GST fusion of Human ISG15 C78SN13YDepositorInsertISG15 (ISG15 Human)
UseTagsGST from plasmid.ExpressionBacterialMutationC78SN13Y; The sequence of ISG15-C78S/N13Y contai…PromoterAvailable sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pInducer20 ALPK1 Y254C
Plasmid#231587PurposeALPK1 gene mutated in position Y254C (Pathogenic mutation in ROSAH syndrome) under control of a doxycycline-inducible promoterDepositorInsertALPK1 (ALPK1 Human)
UseLentiviralTags3X flagExpressionMammalianMutationchanged tyrosine 254 to cysteinePromoterdoxycyclineAvailable sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK1A(K188R)-2A-mCherry
Plasmid#177166PurposeExpresses mouse DYRK1A tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells. Lysine at position 188 substituted with Arginine.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Dyrk1a Mouse)
UseAAVTags2A peptide and mCherryExpressionMammalianMutationChanged Lysine 188 to ArgininePromoterCMV with beta globin intronAvailable sinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
FUW-ubiquitin-EphB3-SV40-GFP (B3G)
Plasmid#65443PurposeExpression of EPHB3 and GFP in mammalian cellsDepositorInsertEPHB3 (EPHB3 Human)
UseLentiviralTagsSV40-EGFPExpressionMammalianMutationPromoterUBQAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK Puro GFP-GABARAPL1 G116
Plasmid#123243PurposeExpression vector with PGK promoter for low expression of EGFP-GABARAPL1 G116. For lentivirus production and stable transduction in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationDeleted amino acid 117. Stop codon after G116PromoterPGKAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EphrinB3-Flag(A227Y)
Plasmid#155013PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EphrinB3 A227Y variant from pcDNA3.1DepositorInsertEphrinB3 (EPHB3 Human)
UseTagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianMutationA227YPromoterCMVAvailable sinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET23a-H6-TEV-cAbl
Plasmid#214234PurposeBacterial expression of the kinase domain of cAbl with a TEV-cleavable N-terminal 6xHis affinity tag; For in vitro tyrosine phosphorylation in peptides/proteins and for kinase specificity screeningsDepositorInsertABL1 Kinase domain (ABL1 Human)
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-FLAG-puro-PTPIP51(1-150_175-470)
Plasmid#170537PurposeExpresses PTPIP51 FFAT-like motif (151-175) deletion mutant (1-150_176-470) in human HeLa cells after transfectionDepositorInsertProtein tyrosine phosphatase interacting protein 51 (RMDN3 Human)
UseTagsFLAG tagExpressionMammalianMutationdeleted amino acids 151-175PromoterCAG promoterAvailable sinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
MERTK_HUMAN_D0
Plasmid#79705PurposeThis plasmid encodes the kinase domain of MERTK. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertMERTK (MERTK Human)
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUW-ubiquitin-EphB4-SV40-GFP (B4G)
Plasmid#65444PurposeExpression of human EPHB4 and GFP in mammalian cellsDepositorInsertEPHB4 (EPHB4 Human)
UseLentiviralTagsSV40-EGFPExpressionMammalianMutationPromoterUBQAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRaGE Pyl TAG GFP Y35TAG
Plasmid#160041PurposeEncodes for MmPyl tRNA synthetase/tRNA pair and for GFP reporter with TAG mutation at site 35, for unnatural amino acid incorporation into the GFP protein in Vibrio natriegens.DepositorInsertsPyrrolysyl tRNA synthetase (Methanosarcina mazei)
Pyrrolysyl tRNA(cua) (Methanosarcina mazei)
deGFP
UseSynthetic BiologyTagsHis-tagExpressionBacterialMutationChanged tyrosine 35 to TAG stop-codon (Site numbe…PromoterP70b promoter and T500 terminator, Vibrio natrieg…Available sinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only