-
Plasmid#213247PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGABBR1 (GABBR1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF6-Lck-TurboID
Plasmid#159433Purposeexpresses Lck-TurboID in mammalian cellsDepositorInsertsUseTagsHAExpressionMammalianMutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V1…PromoterEF-1aAvailable sinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
EPHB4-2A-EGFP
Plasmid#139968PurposeDonor vector to knockin EGFP (separated by 2A) into EPHB4 alleleDepositorInsertHuman EPHB4 knockin homology arms (EPHB4 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-OptoFGFR1-Y766F
Plasmid#59777PurposeExpresses optoFGFR1 with mutation in PLC-gamma binding phosphotyrosine site of FGFR1DepositorInsertOptoFGFR1-Y766F (FGFR1 Human, Mustard Weed)
UseTagsmCitrineExpressionMammalianMutationPromoterCMVAvailable sinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-His-Max-A-PQBP1-Y65C
Plasmid#25803DepositorInsertPQBP1 with Y65C mutation (PQBP1 Human)
UseTagsHis and XpressExpressionMammalianMutationTyrosine 65 within the WW domain of PQBP1 is chan…PromoterAvailable sinceJuly 21, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK Puro GFP-GABARAPL1 G116A
Plasmid#123245PurposeExpression vector with PGK promoter for low expression of EGFP-GABARAPL1 G116A. For lentivirus production and stable transduction in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationGlycine 116 to AlaninePromoterPGKAvailable sinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
EPHB4 gRNA (BRDN0001145313)
Plasmid#76354Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB4DepositorInsertEPHB4 (EPHB4 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
EPHB4 gRNA (BRDN0001144879)
Plasmid#76352Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB4DepositorInsertEPHB4 (EPHB4 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHB4 gRNA (BRDN0001148436)
Plasmid#76353Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB4DepositorInsertEPHB4 (EPHB4 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CmCitrine Lck w/ NosUTRs
Plasmid#66785Purposeexpression of fluorescent membranes in sea urchin primordial germ cellsDepositorInsertLck (LCK Human)
UseSea urchin, zebrafish, xenopusTags3' UTR from sea urchin Nanos, 5' UTR fr…ExpressionMutationTandem repeat of LCK the N-terminal membrane targ…PromoterT7Available sinceJuly 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
EPHB3_HUMAN_D0
Plasmid#79732PurposeThis plasmid encodes the kinase domain of EPHB3. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertEPHB3 (EPHB3 Human)
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA3_HUMAN_D0
Plasmid#79708PurposeThis plasmid encodes the kinase domain of EPHA3. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertEPHA3 (EPHA3 Human)
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHB2_HUMAN_D0
Plasmid#79697PurposeThis plasmid encodes the kinase domain of EPHB2. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertEPHB2 (EPHB2 Human)
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-EGFP-LAMP1-Y414A
Plasmid#222319PurposeSynchronize the trafficking of LAMP1-Y414A from the ER.DepositorInsertStreptavidin-KDEL and LAMP1-Y414A fused to SBP-EGFP (LAMP1 Human)
UseTagsExpressionMammalianMutationTyr414 to AlaPromoterCMVAvailable sinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_CD63YA-SBP-EGFP
Plasmid#222327PurposeSynchronize the trafficking of CD63YA from the ER.DepositorInsertStreptavidin-KDEL and CD63-Y235A fused to SBP-EGFP (CD63 Human)
UseTagsExpressionMammalianMutationTyr235 to AlaPromoterCMVAvailable sinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT7
Plasmid#127515PurposePlasmid encodes H. sapiens codon optimized Integrase 7.DepositorInsertIntegrase 7 coding sequence codon optimized for H. sapiens expression.
UseTagsExpressionMammalianMutationIn 2126 position an G mutated for an T changed th…PromoterAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-Syk-tSH2-FX
Plasmid#111272Purposeexpress murine Syk tandem SH2 domains (Ser 8 to Gln 264), with interdomain A (Phe 119 to His 162) substituted by a flexible 20-amino-acid linker (GGS)3GS(GGS)3, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk tandem SH2 domains (Ser 8 to Gln 264), with interdomain A (Phe 119 to His 162) substituted by a flexible 20aa linker (Syk Mouse)
UseTagsExpressionBacterialMutationinterdomain A (Phe 119 to His 162) substituted by…PromoterT7 promoterAvailable sinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only