We narrowed to 6,244 results for: cas9 expression plasmid
-
Viral Prep#112677-AAV9PurposeReady-to-use AAV9 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available sinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV2)
Viral Prep#112677-AAV2PurposeReady-to-use AAV2 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available sinceJan. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA2-MpCKB
Plasmid#238528PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKB
Plasmid#238527PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKA
Plasmid#238526PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 alphaDepositorInsertMpCKA
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458M-53BP1-DN1S
Plasmid#131045PurposePlasmid encoding Cas9-53BP1-DN1S fusion with BbsI restriction sites for insertion of guide RNA sequence.DepositorInsertSpCas9-53BP1-DN1S (TP53BP1 Human)
UseCRISPRTagsGFP and SpCas9ExpressionMammalianMutationOnly expressing residues 1231-1644 of complete 53…PromoterCBHAvailable sinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 1
Plasmid#51760PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 2
Plasmid#51761PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 4
Plasmid#51763PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 4
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 3
Plasmid#51762PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 3
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 6
Plasmid#51765PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 6
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTetO-hOSK-CASH-1
Plasmid#188977PurposeA CASH-1 GSH targeting, doxycycling inducible humanized Oct4, Sox2, and Klf4 expressing CRISPR/Cas9 donor plasmid.DepositorInsertDoxycycline inducible reprogramming donor cassette
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-S12
Plasmid#84031PurposeTo episomally express codon optimized Cas9 and chimeric guide RNADepositorInsertshSpCas9
eGFP
UseTags3x FLAGExpressionMammalianMutationPromoterCMV and CMV (downstream of F2A self-cleaving pept…Available sinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCB-CBEv2
Plasmid#221139PurposeCoxiella burnetii CRISPR-Cas9 cytosine base editing plasmid version 2 without sgRNA construct. Expresses 3xF-BE4-PpAPOBEC1(H122A).DepositorInsert3xF-PpAPOBEC1(H122A)-Cas9n-UGI-UGI (BE4-PpAPOBEC1(H122A))
UseCRISPRTags3xFLAGExpressionBacterialMutationPromoterlacIq-PtacAvailable sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCB-CBEv1
Plasmid#221138PurposeCoxiella burnetii CRISPR-Cas9 cytosine base editing plasmid version 1 without sgRNA construct. Expresses 3xF-HF-BE3.DepositorInsert3xF-rAPOBEC1-Cas9n(HF)-UGI (HF-BE3)
UseCRISPRTags3xFLAGExpressionBacterialMutationPromoterlacIq-PtacAvailable sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AP568-3
Plasmid#70048Purposeco-expression of Cas9 and crRNA 589 target sequenceDepositorInsertsgRNA for dpy‐10
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP568-2
Plasmid#70047Purposeco-expression of Cas9 and crRNA 589 target sequenceDepositorInsertsgRNA for dpy‐10
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
UseTagsExpressionYeastMutationWTPromoterpGPDAvailable sinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only