We narrowed to 2,640 results for: EXO
-
Plasmid#169264PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 delta Exon 8DepositorInsertNop4 delta E8 (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationdeleted region corresponding to human Exon 8PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-RBM28 dE5
Plasmid#169267PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-RBM28 delta Exon 5DepositorInsertRBM28 delta E5 (RBM28 Human)
Tags3xFLAGExpressionYeastMutationdeleted Exon 5PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-RBM28 dE8
Plasmid#169268PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-RBM28 delta Exon 8DepositorInsertRBM28 delta E8 (RBM28 Human)
Tags3xFLAGExpressionYeastMutationdeleted Exon 8PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
pCDNA_MET_D14_3Flag
Plasmid#182495PurposeContains cDNA of the MET gene without the exon 14DepositorAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
polyQ74-GFP
Plasmid#231893PurposeForms cytosolic HTT partial exon 1 Q74 aggregatesDepositorInsertHTT partial exon 1 Q74 (HTT Human)
TagsEGFPExpressionMammalianMutationCAG repeat expansionAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
EPS15-GFP-His
Plasmid#170860PurposeMammalian expression of EPS15-GFP-His.DepositorInsertEpidermal growth factor receptor pathway substrate 15 (EPS15) (EPS15 Human)
Tags(His)6 and EGFPExpressionMammalianPromoterCMVAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA1-Tat
Plasmid#138478PurposeExpresses HIV Tat for efficient sgRNA packaging.DepositorInsertTat
ExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shcGAS-Hsa
Plasmid#128175PurposeDoxycyclin inducible shRNA knockdown of human cGAS geneDepositorAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-polyQ23-NLS
Plasmid#231891PurposeExpression of non-aggregated HTT partial exon 1 Q23-NLS in the nucleusDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SuExp-hPLD3
Plasmid#201243Purposeexpress full length human PLD3 proteinDepositorAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pASK-mSAN1-Streptag
Plasmid#117165PurposeExpresses Strep-tagged murine SAN1 nuclease in bacteriaDepositorAvailable SinceOct. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG_iPE-N
Plasmid#214734Purposeencodes iPE-N prime editor (with MMLV-RT(H8Y, D200N, T306K, W313F, T330P, L603W) fused to the N terminus of nCas9-H840A) driven by a CAG promoterDepositorInsertCAG_iPE-N_bGH
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG_iPE-C
Plasmid#214735Purposeencodes iPE-C prime editor (with MMLV-RT(H8Y, D200N, T306K, W313F, T330P, L603W) fused to the C terminus of nCas9-N863A) driven by a CAG promoterDepositorInsertCAG_iPE-C_bGH
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICE-HA-MRE11-H63D
Plasmid#82036PurposePlasmid for constitutive or doxycycline-inducible expression of H63D exonuclease-dead mutant of human MRE11. Confers resistance to puromycin. Use T-REx cells for doxycycline-inducible expression.DepositorInsertMRE11 (MRE11 Human)
TagsHAExpressionMammalianMutationExonuclease-dead mutant: H63D MRE11PromoterCMV-tetAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
CaV1.3e[8a,11,31b,Δ32,42a]
Plasmid#49333PurposeRepaired Addgene #26576 to agree with the rat ref sequence. Repairs are @: nt 3310 (GTG->GCG) [Val->Ala]; nt 731 (TCA->GGA) [Ser->Gly].DepositorInsertCACNA1D (Cacna1d Rat)
ExpressionMammalianMutationContains exons 8a, 11, 31b and 42a.Deletion of ex…PromoterCMVAvailable SinceFeb. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shcGAS-Mmu
Plasmid#127698PurposeDoxycyclin inducible shRNA knockdown of mouse cGAS geneDepositorAvailable SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAN056
Plasmid#220052PurposeReporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (positive control).DepositorInsertfLuc-CFTR (exons 22-27) (CFTR Human)
ExpressionMammalianAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAN057
Plasmid#220053PurposeNMD-reporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (c.3846G>A mutation; W1282X).DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF2400
Plasmid#144335PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only