We narrowed to 16,166 results for: grna
-
Plasmid#231158PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlPDSDepositorInsertmobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable sinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL562
Plasmid#231162PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlCHL1DepositorInsertmobile gRNA targeting SlCHL1
ExpressionPlantPromoterPEBV sub-genomicAvailable sinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgAP2S1 #2
Plasmid#202757PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2S1DepositorInsertgRNA targeting AP2S1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgAP2M1
Plasmid#202758PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2M1DepositorInsertgRNA targeting AP2M1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgAP2S1 #1
Plasmid#202756PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2S1DepositorInsertgRNA targeting AP2S1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEARBOCS-v0-Gfap- TagIN-HA
Plasmid#196491PurposeTo tag endogenous mouse GFAP with HADepositorInsertsHA
gRNA
UseAAV and CRISPRExpressionMammalianAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141B-ge4.1
Plasmid#205144PurposeGuide RNA expression cassette harboring AtU3 promoter, ge4.1 5’ modification, and ge4.1 3’ modificationDepositorInsertgRNA cloning site
UseCRISPRPromoterAtU3Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRCreb5gRNA
Plasmid#195021PurposeSequence specific sgRNA that guide Cas9 to the genomic region encoding the bovine Creb5 DNA binding domainDepositorAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOC4 Actb-mRuby3 KI
Plasmid#183437PurposeFlpON knock-in for mRuby3-beta-actin (amino acid position: before start codon)DepositorInsertgRNA and mRuby3 donor
UseCRISPRExpressionMammalianAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Tubb3-4xGFP KI
Plasmid#183445PurposeGFP knock-in for beta3-tubulin-GFP (amino acid position: stop codon)DepositorInsertgRNA and 4xGFP donor
UseCRISPRExpressionMammalianAvailable sinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-2
Plasmid#164859PurposeConstitutive expression of single-spacer CRISPR array with spacer #2 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-2
ExpressionBacterialPromoterJ23119Available sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-3
Plasmid#164860PurposeConstitutive expression of single-spacer CRISPR array with spacer #3 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-3
ExpressionBacterialPromoterJ23119Available sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-3
Plasmid#164867PurposeConstitutive expression of single-spacer CRISPR array with spacer #3 targeting deGFP mRNA for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-3
UseCRISPRExpressionBacterialPromoterJ23119Available sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-2
Plasmid#164866PurposeConstitutive expression of single-spacer CRISPR array with spacer #2 targeting deGFP mRNA for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-2
UseCRISPRExpressionBacterialPromoterJ23119Available sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPEPX-P3-sgRNAluc
Plasmid#85590PurposeIntegrate plasmid of Streptococcus pneumoniae, which can integrate sgRNA targeting luc gene, which encode luciferase, into the locus between amiF and treR. This vector can be used as the template forDepositorInsertsgRNA targeting firefly luciferase encoding gene
UseCRISPRExpressionBacterialPromoterP3Available sinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiCRISPR - EGFP sgRNA 5
Plasmid#51764PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 5
UseCRISPR and LentiviralPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sgPBRM1-1- LentiCRISPRv2
Plasmid#107403PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
gRNA Cloning Vector Bbs I ver. 2
Plasmid#85586PurposeAn empty sgRNA expression vector. sgRNA sequence can be cloned into its Bbs I site. Its gRNA scaffold has efficient ver. 2 structure.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available sinceDec. 5, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
gRNA-CasRx_SD1-pSV40-TagBFP
Plasmid#221004PurposeTransiently express CasRx DR30 repeat with gRNA spacer. Contains SD1 mutation to enhance efficiency. SV40-TagBFP cassette to monitor transfection efficiency. Use BbsI with overhangs Fw-AAAC, Rv-AAAA.DepositorInsertCasRx 30nt processed direct repeat with SD1 mutation
UseCRISPRExpressionMammalianMutationDR1 A>TPromoterU6Available sinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only