-
Plasmid#63214PurposeConstitutively active NFAT1, mutated to interfere selectively with the NFAT:AP-1 interactio. Contains Puromycin selection markerDepositorInsertCA-RIT-NFAT1 (Nfatc2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationAmino acids 1-3 removed; CA: PASSGSSASF mutated t…PromoterAvailable sinceJuly 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQC MCS IRES Puro
Plasmid#110343Purposeγ-Retroviral transfer vector for cloning and expressing your gene of interest. IRES-driven Puromycin selection.DepositorTypeEmpty backboneUseRetroviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
LLP249 pGK-dCas9-DNMT3a V3
Plasmid#100938PurposedCas9 and DNMT WT driven by pGK promoter and Puromycin driven by EF1aDepositorInsertdCas9, DNMT3a catalytic domain (DNMT3A S.pyogenes, Human)
UseCRISPR and LentiviralTags3xHA and 3xTy1ExpressionMammalianMutationD10A, H840A for dCas9PromoterAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 sgKEAP1-1
Plasmid#74985PurposesgKEAP1-1, puromycin selectionDepositorInsertKEAP1 (KEAP1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHL-EF1a-SphcCas9(D10A)-iP-A
Plasmid#60600PurposeExpresses D10A mutant (nickase) of human codon-optimized Cas9 (derived from Streptococcus pyogenes) and pruomycin resistance gene.DepositorInsertsCRISPR Cas9 D10A
puromycin resistance gene
UseCRISPRTagsExpressionMammalianMutationChanged Asp 10 to Ala, Codon usage optimized for …PromoterAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-IRESMuro
Plasmid#82336PurposeBase vector targeting genes to the GAPDH locus of human cells. Inserted genes are expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertIRESMuro
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-mtagtdTom_IRESMuro
Plasmid#82355PurposeVector targeting the mTagtandem tomato gene to the GAPDH locus of human cells. It is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertmtagTandemTomato-IRESMuro
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-eGFP-IRESMuro
Plasmid#82504PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInserteGFP-IRESMuro
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
p53 S23A targeting vector
Plasmid#12167DepositorInsertp53 (Trp53 Mouse)
UseCre/LoxTagsExpressionMammalianMutationSer23 mutation (S23A) in exon 2 and puromycin gen…PromoterAvailable sinceJune 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-LacZ-IRESMuro
Plasmid#82507PurposeVector targeting the LacZ gene to the GAPDH locus of human cells. LacZ is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertLacZ-IRESMuro
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-Clover-Muro
Plasmid#82334PurposeVector targeting the Clover gene to the GAPDH locus of human cells. Clover is expressed from a 2A sequence at the C terminus of GAPDH. Puromycin resistance is encoded by the Muro gene.DepositorInsertClover-T2AMuro
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBIR-GFP
Plasmid#49807PurposeIn vivo GFP based system to measure break induced replication (BIR) repair efficiency. expression of I-SceI generates a double strand break that when repaired by BIR mechanism will restore GFP.DepositorInsertGFP
UseTagsExpressionMammalianMutationPromoterbeta-actinAvailable sinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
FU-H2B-GFP-IRES-Puro
Plasmid#69550PurposeLentiviral, selectable fluorescent GFP tagging of nuclei.DepositorInsertHistone 2B - green fluorescent protein fusion
UseLentiviralTagsGFP fusionExpressionMutationPromoterAvailable sinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMVtight eGFP Puro (w771-1)
Plasmid#26431Purpose2nd generation lentiviral vectorDepositorInsertEnhanced Green Fluorescent Protein
UseLentiviral; Tet-on advanced vectorTagsExpressionMammalianMutationPromoterAvailable sinceJan. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-Nluc
Plasmid#73024PurposeExpress Nluc reporter under EF1 promoterDepositorInsertNluc
UseLentiviralTagsExpressionMammalianMutationPromoterEF1Available sinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-NLS
Plasmid#82518PurposeLentivirus vector. Expresses Halotag proteins with nuclear localization signal in mammalian cells.DepositorInsertNuclear localizaition sequence
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorInsertPPM1A (PPM1A Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Puro
Plasmid#214680PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two empty sgRNA cloning sitesDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only