We narrowed to 2,739 results for: EXO
-
Plasmid#172839PurposeMammalian expression of a sgRNA targeting the intron 17 (last intron) of Camk2a (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 17 of Camk2a under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i5 sgRNA / hSpCas9
Plasmid#172829PurposeMammalian expression of a sgRNA targeting the intron 1 position 5 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i3 sgRNA / hSpCas9
Plasmid#172827PurposeMammalian expression of a sgRNA targeting the intron 1 position 3 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i2 sgRNA / hSpCas9
Plasmid#172826PurposeMammalian expression of a sgRNA targeting the intron 1 position 2 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGxxFP-PIGA
Plasmid#153958PurposeUsed for EGxxFP assay with PIGA intron 5 and exon 6 sequencesDepositorInsertPIGA (a 401-bp fragment from intron 5 and exon 6)
UseA plasmid specific for egxxfp assayTagsN/AExpressionMammalianMutationNo mutationPromoterCAG promoterAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGxxFP-CD55
Plasmid#153959PurposeUsed for EGxxFP assay with CD55 intron 3, exon 4, and intron 4 sequencesDepositorInsertCD55 (a 1,016-bp fragment from intron 3, exon 4, and intron 4)
UseA plasmid specific for egxxfp assayTagsN/AExpressionMammalianMutationNo mutationPromoterCAG promoterAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCI-Neo-p53mut
Plasmid#99239PurposeMutant p53 encoded by AS-30D rat hepatoma cell lineDepositorInsertp53 (Tp53 Rat)
ExpressionMammalianMutationSilent mutations in translated protein at Gly (10…PromoterCMV immediate/early enhancer/promoterAvailable SinceAug. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-SPA mimic WT
Plasmid#92350PurposeTo mimic SPA RNA processing and expressionDepositorInsertSNRPN exon 9, intron9, exon10, intron10 partial partial of SPA1 (SNRPN Human)
ExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Laccase2 MCS-Laccase2 608-1097
Plasmid#69890PurposeExpresses the Drosophila laccase2 exon 2 circular RNADepositorInsertLaccase2 (stw Fly)
ExpressionInsectMutationL158I in laccase2PromoterMetallothionein Promoter (pMT)Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMA3411
Plasmid#46877PurposeA retroviral vector for the constitutive expression of soluble guanylate cyclase1 beta3 double mutant (E473K and C541D)DepositorInsertsoluble guanylate cyclase1 beta 3 (Gucy1b3 Rat)
UseRetroviralMutationE473K, C541DPromoterLTRAvailable SinceAug. 14, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
p414GPD-3xFLAG-Nop4 dE5
Plasmid#169263PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 delta Exon 5DepositorInsertNop4 delta E5 (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationdeleted region corresponding to human Exon 5PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-Nop4 dE8
Plasmid#169264PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 delta Exon 8DepositorInsertNop4 delta E8 (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationdeleted region corresponding to human Exon 8PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-RBM28 dE5
Plasmid#169267PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-RBM28 delta Exon 5DepositorInsertRBM28 delta E5 (RBM28 Human)
Tags3xFLAGExpressionYeastMutationdeleted Exon 5PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-RBM28 dE8
Plasmid#169268PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-RBM28 delta Exon 8DepositorInsertRBM28 delta E8 (RBM28 Human)
Tags3xFLAGExpressionYeastMutationdeleted Exon 8PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
pLJC5-3xHA-eGFP-OMP25
Plasmid#239249Purpose3xHA-eGFP-OMP25 lentiviral overexpression vectorDepositorAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCDNA_MET_D14_3Flag
Plasmid#182495PurposeContains cDNA of the MET gene without the exon 14DepositorAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA flag-Msi1
Plasmid#184029PurposeMsi1 clone with N-terminal flag tagDepositorAvailable SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
CaV1.3e[8a,11,31b,Δ32,42a]
Plasmid#49333PurposeRepaired Addgene #26576 to agree with the rat ref sequence. Repairs are @: nt 3310 (GTG->GCG) [Val->Ala]; nt 731 (TCA->GGA) [Ser->Gly].DepositorInsertCACNA1D (Cacna1d Rat)
ExpressionMammalianMutationContains exons 8a, 11, 31b and 42a.Deletion of ex…PromoterCMVAvailable SinceFeb. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
polyQ74-GFP
Plasmid#231893PurposeForms cytosolic HTT partial exon 1 Q74 aggregatesDepositorInsertHTT partial exon 1 Q74 (HTT Human)
TagsEGFPExpressionMammalianMutationCAG repeat expansionAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only