We narrowed to 2,640 results for: EXO
-
Plasmid#127699PurposeDoxycyclin inducible shRNA knockdown of mouse IFNAR geneDepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only
-
Topo_SpCas9.tracr_AsCas12a.DR
Plasmid#155050PurposeTOPO vector for the cloning of _the SpCas9 tracrRNA - AsCas12a Direct Repeat (DR) fragment into the pLCHKO hgRNA vectorDepositorInsertSpCas9 tracrRNA and AsCas12a Direct Repeat (DR)
UseCRISPRAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
SBP-GFP-Tac-TC
Plasmid#162506PurposeExpresses GFP tagged partial length Tac (TMD and cytosolic tail) in RUSH vector in mammalian cellsDepositorInsertGFP and SBP tagged partial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFP and SBPExpressionMammalianAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_U6_sgRNA_Mettl3C
Plasmid#165420PurposesgRNA construct for targeting Mettl3 C-terminusDepositorAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P-1-SF2
Plasmid#99020PurposeBacterial expression of SF2DepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
608 pSG5L HA RB del ex4
Plasmid#10730DepositorAvailable SinceOct. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
Arf6 T27N- Venus in pcDNA3.1
Plasmid#90464PurposeRhoA mediated cell migrationDepositorAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA flag-Msi1
Plasmid#184029PurposeMsi1 clone with N-terminal flag tagDepositorAvailable SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
ER-CanlonicSF
Plasmid#178343PurposeTo explore endoplasmic reticulum lactate dynamicsDepositorInsertER-CanlonicSF
TagsER Retention Signal, ER Signal Exon 1, and ER Sig…ExpressionMammalianPromoterCMVAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG_NLS-Cas9-XTEN-Ec73RT-NLS_pA_pCMV_BFP_pA
Plasmid#176458PurposeVector for encoding a human codon-optimized SpCas9-XTEN-Ec73RT fusion driven by CAG promoter and tagBFP driven by CMV promoterDepositorInserthumanized S. pyogenes Cas9-XTEN-Ec73RT fusion
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
CD 44 pGL4basic
Plasmid#78135Purposeluciferase reporter for miRNA activityDepositorAvailable SinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSBbiRP Hu Full Length CD142 (Tissue Factor; F3)
Plasmid#183254PurposeExpression of full length human tissue factor (CD142; F3) in a Sleeping Beauty transposon vectorDepositorInsertTissue factor (F3 Human)
ExpressionMammalianAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Prom1 D-5
Plasmid#184017PurposeMammalian Flag tagged expression clone for the mouse Prom1 splicing variant SV8 (GenBank accession BC028286). Deletion of exon 19a (amino acids 696-701), and deletion of amino acids 641 to 655.DepositorInsertProm1 SV8(-Ex19a) D-5 (Prom1 Mouse)
TagsFlagExpressionMammalianMutationDeletion of exon 19a (amino acids 696-701), and d…Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Topo_SpCas9.tracr_LbCas12a.DR
Plasmid#155049PurposeTOPO vector for the cloning of _the SpCas9 tracrRNA - LbCas12a Direct Repeat (DR) fragment into the pLCHKO hgRNA vectorDepositorInsertSpCas9 tracrRNA and LbCas12a Direct Repeat (DR)
UseCRISPRAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tac-TC
Plasmid#162492PurposeExpresses partial length Tac (TMD and cytosolic tail) with GFP tag in mammalian cellsDepositorInsertpartial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its TMD and cysotol…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMA3431
Plasmid#46876PurposeA lentiviral vector for the doxycycline-inducible expression of soluble guanylate cyclase1 alpha3 mutant R592QDepositorInsertsoluble guanylate cyclase 1alpha 3 (Gucy1a3 Rat)
UseLentiviralTagsMycMutationR592QPromoterTRE-TightAvailable SinceAug. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
373_ESR1 in pmiRGlo
Plasmid#78134Purposeluciferase reporter for miRNA activityDepositorInsertESR1 (ESR1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutation3'UTR containing miRNA binding sitesPromoterPGKAvailable SinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDR211
Plasmid#113870Purposeexpression of Cas9 programming sgRNA3 and sgRNA4 targetting HXT8 and HXT1 respectivelyDepositorInsertsgRNA3-HXT8 / sgRNA4-HXT14
ExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only