We narrowed to 6,163 results for: cas9 expression plasmid
-
Plasmid#113348PurposeA sgRNA expression plasmid for genome editing in Pseudomonas aeruginosaDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only
-
AD59_pEP.DonorCLYBL.TS
Plasmid#199227PurposeDonor plasmid with CLYBL target sites for ITPN or HMEJ knock-in at the human CLYBL safe harbor locusDepositorInsertExpression unit for PuroR.T2A.EGFP selectable and reporter markers
UseGene targeting donor plasmidExpressionMammalianPromoterHuman PGK1 gene promoterAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-chiRNA
Plasmid#45946PurposePlasmid for expression of chiRNA under the control of the Drosophila snRNA:U6:96Ab promoter.DepositorInsertU6-BbsI-chiRNA
UseCRISPRExpressionInsectPromoterDm-snRNA:U6:96AbAvailable SinceJune 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Nat
Plasmid#232097PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with NatMX selectionDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Kan
Plasmid#232099PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with KanMX selectionDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg
Plasmid#232098PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with HygMX selectionDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-MBP-NLS-Geo_st
Plasmid#87703PurposeExpression plasmid for Cas9 from Geobacillus stearothermophilus with an N-Term MBP and SV40 NLSDepositorInsertGeoCas9
Tags10xHis-MBP-TEVExpressionBacterialAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-RB-PE2
Plasmid#173903PurposeSB-transposon with inducible expression of SpCas9 PE2DepositorInsertPE2
UseCRISPRTagsSV40 NLSExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only