We narrowed to 31,787 results for: son
-
Plasmid#168273PurposeExpresses MYH9 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMYH9 (MYH9 Human)
TagsFLAGExpressionMammalianAvailable sinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE3g-mNeon-WPRE-pA
Plasmid#192064PurposemNeonGreen expression with TRE3g promoterDepositorInsertmNeonGreen
UseAAVExpressionMammalianPromoterTRE3gAvailable sinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEJS1084_pTetR-P2A-BFP/BspMI flexible sgRNA
Plasmid#117687PurposeU6 driven Spy sgRNA cloning vector where guide sequences are inserted between BspMI sites. This plasmid works with Addgene #108570 for subnuclear proteomic profiling via C-BERST method.DepositorInsertsKanamycin cassette
TetR-P2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromoterU6 and hPGKAvailable sinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS654 All-in-One AAV-sgRNA-hNmeCas9
Plasmid#112139PurposeDelivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing.DepositorInsertssgRNA scaffold
Human-codon-optimized NmeCas9
UseAAV, CRISPR, and Mouse TargetingExpressionMammalianPromoterU1a and U6Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCK302
Plasmid#87768PurposeAs pCK301 (E. coli rhaBAD promoter upstream of sfGFP, sfGFP can be replaced with any gene of interest), but rhaS cloned downstream of ampR, which allows non-metabolisable inducer L-mannose to be usedDepositorInsertsPrhaBAD-sfGFP
rhaS from E. coli with its native RBS from E. coli
UseSynthetic BiologyTags6xHis TagExpressionBacterialPromoterPrhaBAD rhamnose-inducible promoter from E. coli …Available sinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
FUS-Citrine-PixE
Plasmid#111505PurposeFor PixELL systemDepositorAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
2XMyc-LRRK2-Y1699C
Plasmid#25364DepositorPublicationInsertLRRK2 (LRRK2 Human)
Tags2XMycExpressionMammalianMutationTyrosine 1699 mutated to CysteineAvailable sinceJune 22, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-Frankenbody-FLAG-Halo
Plasmid#175296PurposeTrack mature and nascent FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with HaloTag
TagsHaloTagExpressionMammalianAvailable sinceOct. 7, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCRISPRi_Mxi1_yl
Plasmid#91248PurposeCRISPR-dCas9-Mxi1 vector for Yarrowia lipolytica, expressing dCas9-Mxi1 and AvrII site for sgRNA insertionDepositorInsertsCodon optimized dCas9-Mxi1
sgRNA expression cassette
UseCRISPR and Synthetic BiologyExpressionYeastPromoterSCR1'-tRNA and UAS1B8-TEF(136)Available sinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMRE145
Plasmid#118497Purposebroad-host range plasmid to constitutively express fluorescent protein genes in bacteriaDepositorInsertmScarlet-I
ExpressionBacterialAvailable sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSP1673
Plasmid#65769PurposeBacterial expression plasmid for S. thermophilus1 Cas9 & sgRNA (need to clone in spacer into BspMI sites): T7-humanSt1Cas9-NLS-T7-BspMIcassette-St1-sgRNADepositorInsertmammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS, and St1Cas9 gRNA
UseCRISPRTagsNLSExpressionBacterialPromoterT7 (x2)Available sinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCR1316
Plasmid#111126PurposeExpresses FANCA.DepositorAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
NES-EGFP-PH-ARNO2G-I303Ex2
Plasmid#116868PurposePIP3 biosensorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCYTH2 (CYTH2 Human)
TagsEGFP and X.leavis map2k1.L(32-44)ExpressionMammalianMutationamind acids 252-399, isoleucine 303 changed to gl…Available sinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHN781
Plasmid#178828PurposeBacterial expression for human Saposin ADepositorInsertartificial gene encoding human Saposin A (AR Human)
TagsHis8, TEVExpressionBacterialMutationCodon-usage was optimized for bacterial expressio…PromoterT7Available sinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
mDsRed-Golgi-7
Plasmid#55832PurposeLocalization: Golgi, Excitation: 557, Emission: 585DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGolgi (B4GALT1 Human)
TagsmDsRedExpressionMammalianMutationaa 1-82 of NM_001497.3PromoterCMVAvailable sinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Sniper2L
Plasmid#193856PurposeExpresses human codon-optimized Sniper2L and blasticidin resistance: EFS promoter-Sniper2L-NLS-FLAG-P2A-BSDDepositorInsertSniper2L
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianMutationE1007LPromoterEFSAvailable sinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFasBac+GFP-CAMSAP3
Plasmid#59038Purposefor baculovirus expression of mouse CAMSAP3 in Sf9 cellsDepositorAvailable sinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EB3N-VVDfast-mCl3-iLID
Plasmid#190165PurposeExpresses EB3N-VVDfast-mCl3-iLID, a microtubule anchor used for optogenetic recruitment of SspB-mCh-p60, in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEB3N-VVDfast-mClover3-iLID (MAPRE3 Synthetic, Human)
Tags-VVDfast-mClover3-iLIDExpressionMammalianMutation1-189 aa from EB3Available sinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA5/FRT/TO-GAlphai1-RLuc8
Plasmid#140973PurposeEncodes a G alpha subunit (GNAl1) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGAlphai1-RLuc8 (GNAI1 Human)
UseSynthetic BiologyExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only