175,750 results
-
Plasmid#221615PurposeA recombinant AAV2 plasmid encoding vfChrimson-citrine with trafficking enhancement and soma targeting with KV2.1 motif.DepositorInsertvfChrimson-citrine with membrane trafficking enhancement and soma targeting
UseAAVMutationvfChrimson-citrine with membrane trafficking enha…PromoterHuman SynapsinAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaAnillin homology domain
Plasmid#187277PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Anillin homology domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaAnillin homology domainPromoterU6, CMVAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-837_NY-ESO-1_TCR_tFAS
Plasmid#207500PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInserttFAS, NY-ESO-1_TCR (FAS Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBP-P_luxR-PLuxB
Plasmid#204073PurposeType 0 promoter partDepositorInsertluxR-PLuxB repressor and PLuxB 3OC6-AHL-inducible promoter
ExpressionBacterialMutationNoneAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBP-P_rhaS-PRhaB
Plasmid#204076PurposeType 0 promoter partDepositorInsertrhaS activator and PRhaB rhamnose-inducible promoter
ExpressionBacterialMutationNoneAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSrtA-MT3
Plasmid#200305PurposeBacterial expression plasmids for self cleavable sortase mediated purification of recombinant MT3. Contains His-tag, SUMO-tag, LPETG sortase recognition motif and eSrtADepositorAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-Rem2 R236A/L263A
Plasmid#51589Purposeexpresses RNAiR myc-tagged Rem2 non-Ca channel interactingDepositorInsertRem2 (Rem2 Mouse)
TagsmycExpressionMammalianMutationR236A and L263A; silent mutations at shRNA 1 and …PromoterCMVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmal_c5x_RNAse_Inhib
Plasmid#153314PurposeBacterial expression of an RNase inhibitorDepositorInsertRNAse Inhibitor
TagsMaltose Binding ProteinExpressionBacterialAvailable SinceJune 2, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV.GFAP.eGFP.WPRE.hGH (AAV5)
Viral Prep#105549-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.GFAP.eGFP.WPRE.hGH (#105549). In addition to the viral particles, you will also receive purified pAAV.GFAP.eGFP.WPRE.hGH plasmid DNA. GFAP-driven GFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGFAPTagsEGFPAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only