We narrowed to 6,790 results for: GCA;
-
Plasmid#111296PurposeCRISPR KO murine MUTDepositorInsertsgRNA1 against murine MUT
UseCRISPR and LentiviralExpressionMammalianAvailabilityAcademic Institutions and Nonprofits only -
pAAV.GfaABC1D.PI.Lck-GFP.SV40
Plasmid#105598PurposeAAV expression of membrane bound EGFP from GfaABC1D promoterDepositorHas ServiceAAV5InsertLck-EGFP
UseAAVExpressionMammalianPromoterGfaABC1DAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
QPM-sgR (pTaU3)
Plasmid#140448PurposeFor sgRNA expression in monocotyledons protoplastsDepositorInsertTaU3-sgRNA
UseCRISPRExpressionPlantPromoterTaU3Available SinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shBRCA1 #2
Plasmid#44595DepositorAvailable SinceMay 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
7b sgRNA for EJ7-GFP reporter
Plasmid#113624PurposesgRNA/CAS9 expression plasmid to induce the 3’ double-strand break in the EJ7-GFP reporterDepositorInsert7b sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-PspCas13b-GEMSgRNA2
Plasmid#204768PurposepU6-PspCas13b-gRNA-Actb1216 backbone (Addgene ID: 155368) containing guide RNA #2 targeting the GEMS m6A reporter mRNA sequence.DepositorInsertguide RNA targeting GEMS m6A sensor mRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKL004
Plasmid#98920PurposeConstitutively expresses the calcium sensor GCaMP6f tethered to mRuby3 under the Sigma 70 promoter in E. coli.DepositorInsertGCaMP6f tethered to mRuby
TagsHis and mRuby3ExpressionBacterialPromoterBBa_J23118 - Strong ConstitutiveAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB5191
Plasmid#126911PurposePlasmid containing gRNA expression cassettes targeting the X-4 and XII-5 integration sites in Saccharomyces cerevisiaeDepositorInsertX-4 and XII-5 gRNA
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAG-EGFP-Otx2shRNA1
Plasmid#73981PurposeOtx2 shRNA1 (mir155 backbone) was inserted into the 3'UTR of EGFP.DepositorInsertshRNA that targets the mouse Otx2 gene
ExpressionMammalianPromoterCAGAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_TEAD3_1
Plasmid#86337PurposeEncodes gRNA for 3' target of human TEAD3DepositorInsertgRNA against TEAD3 (TEAD3 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBa.Lamp1-GFP
Plasmid#180250PurposeMammalian expression of LAMP1DepositorAvailable SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
7h sgRNA for 4-μHOM reporter
Plasmid#113625PurposesgRNA/CAS9 expression plasmid to induce a 3’ double-strand break in the 4-μHOM reporter at the edge of the microhomology.DepositorInsert7h sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgRNA 2 GAPDH
Plasmid#83809PurposeExpress Sg-2 sgRNA targeting GAPDHDepositorInsertSgRNA
UseCRISPRAvailable SinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKL002
Plasmid#98921PurposepET DUET backbone with PROPS voltage indicator and GCaMP6f calcium sensor in the two MCS.DepositorInsertsPROPS
GCaMP6f
ExpressionBacterialPromoterT7Available SinceAug. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
TBP6.7 non-targeting gRNA lambda phage
Plasmid#132547Purposeexpresses gRNA for TBP-based CIRTSDepositorInsertgRNA TBP-based CIRTS
ExpressionMammalianPromoterhU6 promoterAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
SlutrCas9
Plasmid#163795PurposeExpresses SlutrCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiGuidPuro-hTP73_sgRNA-1
Plasmid#88855PurposeCRISPR KO of Trp73DepositorInsertTrp73
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
MLSE-shREN
Plasmid#105583Purposeretrovirally express control shRNA with GFP markerDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pG3H-U6SC
Plasmid#134755PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA-U6, zCas9-35SCAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only