We narrowed to 7,986 results for: ski
-
Plasmid#191337PurposeExpresses the fluorescently labeled plus-end directed KIF13a motor domain fused to the dimerization domain FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pAPM-D4 miR30-DNMT3a ts3
Plasmid#115867PurposeDNMT3a knockdownDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P POLD1_1
Plasmid#160791PurposeSuppress POLD1DepositorInsertshPOLD1_1
UseLentiviralAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P REV3L_2
Plasmid#160798PurposeSuppress REV3LDepositorInsertshREV3L_2
UseLentiviralAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
B*07:05:01
Plasmid#203268PurposeOverexpress HLA alleleDepositorInsertB*07:05:01 (HLA-B Human)
ExpressionMammalianAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1B POLE1_2
Plasmid#160765PurposeSuppress POLE1DepositorInsertshPOLE1_2
UseLentiviralAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1B POLE1_1
Plasmid#160763PurposeSuppress POLE1DepositorInsertshPOLE1_1
UseLentiviralAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-AGO3 ts3
Plasmid#115858PurposeAGO3 knockdownDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-AGO3 ts2
Plasmid#115857PurposeAGO3 knockdownDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP
Plasmid#183926PurposeOptogenetic PHR domain coupled to GFP; binds to CIBN upon blue light exposureDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/Puro/FA/GFP-N--Grb2-4
Plasmid#112839Purposetransient/stable overexpressionDepositorAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P MUTYH_2
Plasmid#160786PurposeSuppress MUTYHDepositorInsertshMUTYH_2
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P MUTYH_1
Plasmid#160785PurposeSuppress MUTYHDepositorInsertshMUTYH_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-PIWIL2 ts3
Plasmid#115869PurposePIWIL2 knockdownDepositorAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-PIWIL2 ts1
Plasmid#115868PurposePIWIL2 knockdownDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
Mouse c-myc (exons II and III)
Plasmid#8448DepositorInsertMouse c-myc (exons II and III) (Myc Mouse)
ExpressionBacterialMutationExons II and III onlyAvailable SinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34∆RBS
Plasmid#247213PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP35∆RBS
Plasmid#247214PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only