We narrowed to 28,063 results for: RON
-
Plasmid#180779PurposeSars-CoV-2 variant proteinDepositorInsertMAC-N SARS-CoV-2 Omicron spike protein
TagsMAC-tagExpressionMammalianMutationS371L, H69-V70-, S373P, S375F, G339D, N211-, N440…Available SinceSept. 26, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-Synapsin-NLS-Dronpa-optoNES-WPRE
Plasmid#159944Purposeoptical regulation of nuclear exportDepositorInsertNLS-Dronpa-optoNES
UseAAVExpressionMammalianMutationsyntheticPromoterhSyn1Available SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral human Citron shRNA 1 RFP i670
Plasmid#155345PurposeLentiviral expression of humnan CIT shRNA, RFP i670 expression, based on Addgene 12247DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated N-terminal (N) O-Glycosylation site
Plasmid#120404Purposeenables eukaryotic expression of human plasma fibronectin in which the first O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContaining complete variable region with a mutati…PromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-mCherry-1x miR30 SCR
Plasmid#216393Purposetransfer plasmid for AAV vector production of mCherry and miR scramble (no target)DepositorInsertmcherry and miR control
UseAAVPromoterCMVenh synapsinAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-JNKKTRrsGreenF-E-2A-ERKKTRrsFastLime-IRES-PKAKTRClover-2A-P38KTRDronpa
Plasmid#205766PurposeExpression of JNK KTR rsGreenF-E, ERK KTR rsFastLime, PKA KTR Clover, and P38 KTR Dronpa in mamalian cellsDepositorInsertJNK KTR rsGreenF-E-2A-ERK KTR rsFastLime-IRES-PKA KTR Clover-2A-P38 KTR Dronpa
UseAAVExpressionMammalianMutationwtAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI) 0.5 Syn-intron-hfCas13d-pA
Plasmid#233039PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a 0.5 bp synapsin promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA/EF1a-mCherry-WPRE-pa
Plasmid#233034PurposeTo Express HA tagged hfCas13d the CMV promoter. Also encodes a mCherry gene outside of the viral genomeDepositorInserthfCas13d and mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DjCas13d-pA/EF1a-mCherry-WPRE-pa
Plasmid#233033PurposeTo Express HA tagged DjCas13d the CMV promoter. Also encodes a mCherry gene outside of the viral genomeDepositorInsertDjCas13d and mCherry
UseAAVTagsmCherryAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Dlx5/6-Chronos-eGFP-p2a-nls-mScarlet
Plasmid#121543PurposeChronos with red nucleus-targeted fluorescence for inhibitory neuronsDepositorInsertblue-absorbing channelrhodopsin Chronos with eGFP and nls-mScarlet
UseAAVPromoterdlx5/6Available SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSF4 CMV intron renilla TRICK CTE polyA
Plasmid#84443PurposeTRICK reporter mRNADepositorInsertRenill-TRICK
UseLuciferase; FrtExpressionMammalianPromoterTet-CMVAvailable SinceNov. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro GFP-REX1[degron]-IRES-mCherry
Plasmid#232240PurposeMammalian expression of REX1[degron]-GFP-IRES-mCherryDepositorInsertREX1[degron]-GFP-IRES-mCherry (Zfp42 Mouse)
TagsAcGFP1ExpressionMammalianMutationREX1 (aa 70-85)Available SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBT268_(pCA-ATG-intron-tTA2-iiTRE-tdT3Mycii)
Plasmid#36880DepositorInsertstTA2
tdT-3Myc
insulator
Tags3 Myc tagsExpressionMammalianMutationinsertion of a beta-globin intron with a loxP sit…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-GtACR2-P2A-Voltron2ST-W3SL
Plasmid#217676PurposeAAV-mediated, Cre-dependent co-expression of GtACR2 and soma-targeted Voltron2 (ORCHID) for assessing inhibitory receptor driving force through voltage imaging with concurrent activation of GtACR2.DepositorInsertGtACR2-P2A-Voltron2ST
UseAAVTagsSoma targeting sequence (Kv2.1) on Voltron2 gene …ExpressionMammalianPromoterEF‐1αAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV Synapsin Intron H2B Gcamp 6s wpre Pzac2.1
Plasmid#74150Purposecalcium sensorDepositorInsertGCaMP6s
UseAAVTagsH2BPromoterSynapsinAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV Synapsin Intron H2B Gcamp 6f wpre Pzac2.1
Plasmid#74144PurposeCalcium sensorDepositorInsertGCaMP6f
UseAAVTagsH2BPromotersynapsinAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) Laccase2 MCS-ZKSCAN1 548-1417 (No intron)
Plasmid#69898PurposeExpresses a miniature version of the ZKSCAN1 circular RNA in mammalian cellsDepositorAvailable SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBT270_(pCA-G-intron(Neo)-tTA2-iiTRE-tdT3Mycii)
Plasmid#36881DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLN193 (SSX1p-[mK-Ex1]-[miR1-Mv3 intron]-[mK-Ex2]-BS(Pe))
Plasmid#105210PurposeModule 1 - SSX1 promoter drives self-inhibiting mKate2 expression (Version 3 intron - see PMID: 29056342 for detailed information)DepositorInsertSSX1p-[mK-Ex1]-[miR1-Mv3 intron]-[mK-Ex2]-BS(Pe)
UseSynthetic BiologyExpressionMammalianAvailable SinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only