We narrowed to 7,749 results for: lentivirus vector
-
Plasmid#110414PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLIK_Zeo_3xflag_Luciferase
Plasmid#136533PurposeLentiviral expression vector for an inducible 3xflag-tagged LuciferaseDepositorInsertLuciferase
UseLentiviral; Destinatioin vector for gateway cloni…Tags3x FLAGExpressionMammalianAvailable sinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-TARDBP-G287A_VA
Plasmid#141328PurposeLentiviral vector for expression of C-terminally VA-tagged human TARDBP-G287A in mammalian cellsDepositorInsertTARDBP-G287A (TARDBP Human)
UseLentiviralTagsVA tag (Beacon-2XStrep-6XHis-2XTEV-3XFLAG)ExpressionMammalianMutationG287AAvailable sinceJune 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-TARDBP-G368A_VA
Plasmid#141330PurposeLentiviral vector for expression of C-terminally VA-tagged human TARDBP-G368A in mammalian cellsDepositorInsertTARDBP-G368A (TARDBP Human)
UseLentiviralTagsVA tag (Beacon-2XStrep-6XHis-2XTEV-3XFLAG)ExpressionMammalianMutationG368AAvailable sinceJune 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-TARDBP-W385G_VA
Plasmid#141331PurposeLentiviral vector for expression of C-terminally VA-tagged human TARDBP-W385G in mammalian cellsDepositorInsertTARDBP-W385G (TARDBP Human)
UseLentiviralTagsVA tag (Beacon-2XStrep-6XHis-2XTEV-3XFLAG)ExpressionMammalianMutationW385GAvailable sinceJune 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
TBG-mTSG
Pooled library#113585PurposeAAV-CRISPR library for pool mutagenesis of top tumor suppressor genes in mouse liverDepositorExpressionMammalianUseAAV, CRISPR, Lentiviral, and LuciferaseAvailable sinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
WPXL SOX10 gRNA
Plasmid#101923PurposeSOX10 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertSOX10 promoter targeting gRNA
UseLentiviralAvailable sinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCVL RipTAL(Nd154C63) SFFV Age-Xho/Xba-Sal linkers
Plasmid#50626PurposepRipTAL plasmid for cloning of megaTALs or other TAL-fusions and expression in mammalian cells. RVDs are cloned between Age-Xho sites and meganuclease/fusion is cloned between Xba-Sal sites.DepositorTypeEmpty backboneUseLentiviral and TALENExpressionMammalianAvailable sinceMay 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
LeGO-1xT
Plasmid#27352DepositorPublicationInsertU6 promoter, SFFV promoter, dTomato
UseLentiviralExpressionMammalianAvailable sinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-Flag-PolB(K206A/K244A/T304I)-Puro
Plasmid#177145PurposeLentiviral vector expressing Flag-PolB(K206A/K244A/T304I) and a puromycin resistance cassetteDepositorAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-ATL2-WPRE-UbC-Emerald
Plasmid#225945PurposeLentiviral vector plasmid expressing human atlastin GTPase 2 (ATL2) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable sinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1C-YFP-shRB1-733
Plasmid#244458PurposeExpresses EYFP and an shRNA against RB1 in mammalian cellsDepositorAvailable sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
783-Rx-mU6: RfxCas13d gRNA and array cloning backbone
Plasmid#228361PurposemU6-driven expression of RfxCas13d gRNAs and arrays. Contains AarI sites for guide cloning.DepositorTypeEmpty backboneUseCRISPR and Lentiviral; Rfxcas13d grna expression …ExpressionMammalianPromotermU6Available sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-ATL3-WPRE-UbC-Emerald
Plasmid#225946PurposeLentiviral vector plasmid expressing human atlastin GTPase 3 (ATL3) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-LNPK-WPRE-UbC-Emerald
Plasmid#225953PurposeLentiviral vector plasmid expressing human lunapark (LNPK) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-LNPK-WPRE-UbC-mCherry
Plasmid#225954PurposeLentiviral vector plasmid expressing human lunapark (LNPK) under the spleen focus-forming virus (SFFV) promoter and mCherry under the Ubiquitin C (UbC) promoterDepositorAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4(1-131)-WPRE-UbC-Emerald
Plasmid#225955PurposeLentiviral vector plasmid expressing human CKAP4 mutant lacking the luminal domain under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationTruncated CKAP4 (1-131) lacking the luminal domainPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4(2xlumen)-WPRE-UbC-Emerald
Plasmid#225956PurposeLentiviral vector plasmid expressing human CKAP4 mutant with an additional luminal domain under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationFull-length CKAP4 with additional luminal domain …PromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-RTN4-WPRE-UbC-Emerald
Plasmid#225938PurposeLentiviral vector plasmid expressing human reticulon 4 (RTN4) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-STIM1-WPRE-UbC-Emerald
Plasmid#225939PurposeLentiviral vector plasmid expressing human stromal interaction molecule 1 (STIM1) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only