169,450 results
-
Plasmid#168054PurposeReplaces Addgene plasmid 118461. Yeast tagging vector to create a gene fusion with yeast optimized tdTomato with CaUra3 selection; Contains the linker region at the 5’ end of the FPDepositorInsertytdTomato
TagsytdTomatoExpressionYeastAvailable SinceJune 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-P(Per2)-DIO-intron2-dLUC
Plasmid#110059PurposePer2 transcription luciferase reporterDepositorInsertPer2 promoter and luciferase (Per2 Mouse)
UseAAV and Cre/LoxExpressionMammalianPromoterPer2Available SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
HOP-flash
Plasmid#83467PurposeTEAD-YAP/TAZ tx activity reporter. 8xwt TEAD binding sites with minimal promoter plus luciferase reporter geneDepositorInsertMultimerized TEAD binding sites in the promoter of CTGF with minimal promoter (CCN2 Human)
UseLuciferaseAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-gRNA(anti-sense) hUbC-VP64-dCas9-VP64-T2A-GFP
Plasmid#66707Purposeexpresses a single gRNA and VP64-dCas9-VP64DepositorInsertshU6-gRNA expression cassette
S.Pyogenes VP64-dCas9-VP64
UseLentiviral and Synthetic BiologyTagsVP64MutationD10A and H840APromoterhU6 and hUbCAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
p44K
Plasmid#45800DepositorTypeEmpty backboneExpressionBacterialAvailable SinceSept. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG-D12L
Plasmid#89161PurposeExpress vaccinia virus D12L in mammalian cellsDepositorInsertVaccinia virus D12L
ExpressionMammalianPromoterCAG promotorAvailable SinceApril 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-FLAG-METTL3-APPA
Plasmid#160251PurposeExpress catalytic inactive FLAG-METTL3 in human cellsDepositorInsertmethyltransferase like 3 (METTL3 Human)
TagsFLAGExpressionMammalianMutationchanges in aa 395–398, DPPW → APPAPromoterCMVAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-PDi-CRISPRn
Plasmid#73500PurposeDox-inducible CRISPR nuclease (CRISPRn) knock in construct into the AAVS1 locusDepositorInsertsCas9
rtTA
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCAG and TREAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRecT_2
Plasmid#167546PurposeEncodes an IPTG inducible recT from E. faecium Com15 used to ectopically express recT in Enterococcus for recombineering.DepositorInsertE. faecium Com15 recT under an IPTG inducible promoter, with lacI
ExpressionBacterialPromoterIPTGAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only