We narrowed to 8,087 results for: 104
-
Plasmid#204104PurposeType 0 tag-compatible RBS partDepositorInsertMCD22 weak RBS for assembly with tag part
ExpressionBacterialMutationNoneAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
KBB528
Plasmid#185104PurposeC-terminal truncation of Pom152 fused to GFPDepositorInsertPOM152
TagsGFPExpressionYeastMutationPOM152(1-???)-HA-GFPAvailable SinceJuly 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
SLAH2
Plasmid#117104Purposeprotein expression in yeastDepositorAvailable SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiV2-dCas9-VP64
Plasmid#141104PurposeExpression of gRNA and dCas9-VP64 from the same plasmid for CRISPRaDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
V37m
Plasmid#121043PurposeMoClo golden gate assembly AE destination vector DVCK-AE-mScar (ColE1/kan resistance destination vector with constitutive mScarlet expressing for screening.DepositorInsertKan destination vector with ColE1 origin and mScarlet selection
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
V35m
Plasmid#121042PurposeMoClo golden gate assembly AE destination vector DVCK-AE-GFP (ColE1/kan resistance destination vector with constitutive GFP expression for screening.DepositorInsertKan destination vector with ColE1 origin and GFP selection
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shGFP
Plasmid#110419PurposeshGFP control, silence GFP gene, blasticidin selection.DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Moesin-N-14
Plasmid#55104PurposeLocalization: Cytoskeleton/Membrane, Excitation: 587, Emission: 610DepositorAvailable SinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
UC20m
Plasmid#121040PurposeMoClo golden gate assembly DE part for gN2 gRNA (guide RNA for S. pyogenes Cas9; sequence designed with NUPACK for stable tracrRNA structure and open targeting region).DepositorInsertgN2 Cas9 gRNA UC part
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shGFP
Plasmid#110421PurposeshGFP control, silence GFP gene, doxycycline inducible, puromycin selectionDepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shLuc
Plasmid#110422PurposeshLuc control, silence Luc gene, doxycycline inducible, puromycin selectionDepositorInsertLuciferase
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1-WT-short-UBASH3A
Plasmid#192104PurposeBacterial expression of human wild-type short-form UBASH3A with GST tagDepositorAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Protein2PAM_NmeN4CNNT.2
Plasmid#250223PurposeExpress Protein2PAM_NmeN4CNNT.2 nuclease in human cells using a CMV promoterDepositorInsertNmeN4CNNT.2
UseCRISPRTagsNLS-3xFLAGExpressionMammalianMutationNme1Cas9 I1010K/F1017L/A1021I/C1023F/H1024D/I1034…PromoterCMVAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
Francisella tularensis enoyl reductase
Plasmid#231104PurposeExpresses FabI under T7 with HIS tagDepositorInsertEnoyl-acyl carrier protein reductase
Tags6x HIS, GSTExpressionBacterialAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
HCP2
Plasmid#166104PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
UCT1m
Plasmid#121041PurposeMoClo golden gate assembly DE part for gQi gRNA (guide RNA for S. pyogenes Cas9; sequence from DOI: 10.1016/j.cell.2013.02.022). Please see Supplemental Documents for annotated Genbank file.DepositorInsertUCT-part guide RNA (Stanley Qi sequence)
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pBN63
Plasmid#35104DepositorInsertfcy1PR
UseYeast replicatingAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
4MYJ
Plasmid#60104PurposeBaculovirus expression for structure determination; may not be full ORFDepositorInsertPF14_0346:MAC04G-A11:C228843
UseBaculovirus expressionTags6xHis-TEV and MHHHHHHSSGRENLYFQGMutationSee commentsPromoterPolyhedrinAvailable SinceOct. 22, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits