We narrowed to 1,892 results for: BRE
-
Plasmid#188016PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted 2aGal4VP16 protein trap; secondary marker gamma crystallin GFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; gamma crystallin promotorAvailable sinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GBH-2aG4-gcryGFP.2
Plasmid#188017PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted 2aGal4VP16 protein trap; secondary marker gamma crystallin GFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; gamma crystallin promotorAvailable sinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GBH-2aG4-gcryGFP.3
Plasmid#188018PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted 2aGal4VP16 protein trap; secondary marker gamma crystallin GFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; gamma crystallin promotorAvailable sinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-h.Rhno1 T52A (B)-C-Myc-DDK-P2A-Puro
Plasmid#211621PurposeRhno1 T52ADepositorAvailable sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-h.Rhno1 S51A (A)-C-Myc-DDK-P2A-Puro
Plasmid#211620PurposeRhno1 S51ADepositorAvailable sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-h.Rhno1 S163A (E)-C-Myc-DDK-P2A-Puro
Plasmid#211624PurposeRhno1 S163ADepositorAvailable sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-h.Rhno1 S162A (D)-C-Myc-DDK-P2A-Puro
Plasmid#211623PurposeRhno1 S162ADepositorAvailable sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-h.Rhno1 S164A (F)-C-Myc-DDK-P2A-Puro
Plasmid#211625PurposeRhno1 S164ADepositorAvailable sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-h.Rhno1 S178A (G)-C-Myc-DDK-P2A-Puro
Plasmid#211626PurposeRhno1 S178ADepositorAvailable sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 Ta-sro1 SR3
Plasmid#192547PurposepENTR plasmid Triticum aestivum sro1, full CDS, cultivar SR3, no stop codonDepositorInsertSIMILAR TO RCD ONE 1 (SRO1), cultivar Shanrong No. 3 (SR3)
UseGateway CloningAvailable sinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D
Plasmid#115193PurposeLentiviral transduction and expression of PDHA2S291D into any mammalian cellDepositorAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19 KGA HA5'-mKO2-3'
Plasmid#110406PurposeHomology donor for glutaminase KGA isoform knock-in, mKO2DepositorAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shGDF11 #2
Plasmid#83084PurposeLentiviral shRNA vector for inducible knockdown of human GDF11DepositorAvailable sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pMSCV-ALDH1A1
Plasmid#260552PurposeExpressing human ALDH1A1 using the pMSCVpuro retroviral vector is a standard, robust method for generating stable overexpressing cell linesDepositorAvailable sinceAug. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO H2BmRFP-2A-Plgrkt Δ139-147 v4 trcr filler
Plasmid#256784Purposelentiviral construct with H2BmRFP-2A-Plgrkt (mouse) Δ139-147 and U6 driven gRNA cassette with the v4 modified trcrRNA. gRNAs can be cloned in by digesting the filler with BsmBI.DepositorAvailable sinceJune 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO.1-puro-shCHD1_A
Plasmid#247237PurposeshRNA knockdown of human CHD1DepositorAvailable sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO.1-puro-shCHD1_B
Plasmid#247238PurposeshRNA knockdown of human CHD1DepositorAvailable sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only