We narrowed to 29,146 results for: Tat
-
Plasmid#153433PurposeHomology Directed Repair construct for N-terminal tagging of hsCTNNB1 with mTurquoise2DepositorInsertCTNNB1 homology arms and mTurquoise2 coding sequence (CTNNB1 Human)
UseCRISPR; Hdr donor templateTagsmTurquoise2Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTH2-L22V
Plasmid#116639PurposeLentiviral expression of PTH2 L22VDepositorAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PTH2
Plasmid#116781PurposeLentiviral expression of PTH2DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-NOTCH2NL
Plasmid#116766PurposeLentiviral expression of NOTCH2NLDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TBC1D3B-R162Q
Plasmid#116694PurposeLentiviral expression of TBC1D3B R162QDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-WDR12-Q93K
Plasmid#116706PurposeLentiviral expression of WDR12 Q93KDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TBC1D3B-G164E
Plasmid#116692PurposeLentiviral expression of TBC1D3B G164EDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-NOTCH2NL-G137L
Plasmid#116439PurposeLentiviral expression of NOTCH2NL G137LDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-NOTCH2NL-Q172_G173delinsHC
Plasmid#116440PurposeLentiviral expression of NOTCH2NL Q172_G173delinsHCDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-NOTCH2NL-R87M
Plasmid#116441PurposeLentiviral expression of NOTCH2NL R87MDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-NOTCH2NL-S165F
Plasmid#116442PurposeLentiviral expression of NOTCH2NL S165FDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-OXA1L-L57F
Plasmid#116445PurposeLentiviral expression of OXA1L L57FDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-OXA1L-P58S
Plasmid#116446PurposeLentiviral expression of OXA1L P58SDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
ORAI1-YFP V107M-L273D-L276D
Plasmid#114183PurposeORAI1 channel with C-terminal YFP, carrying the constitutively activating mutation V107M from TAM, and the mutations L273D-L276D leading to a deficiency in STIM1-mediated gating.DepositorInsertORAI1-YFP V107M-L273D-L276D (ORAI1 Human)
TagsYFPExpressionMammalianMutationV107M/L273D/L276DAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
ORAI1-YFP T184M-L273D-L276D
Plasmid#114184PurposeORAI1 channel with C-terminal YFP, carrying the activating mutation T184M from TAM, and the mutations L273D-L276D leading to a deficiency in STIM1-mediated gating.DepositorInsertORAI1-YFP T184M-L273D-L276D (ORAI1 Human)
TagsYFPExpressionMammalianMutationT184M/L273D/L276DAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_VPEVS
Plasmid#105863PurposeExpression plasmid coding for mutated heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG3 heavy chain (Ighg3 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG3 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_ILGGP
Plasmid#105855PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG1 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH2charge
Plasmid#105852PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. Introduced mutations modify charge of CH2 domain.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG1, muatations: Gl…PromoterhEF1-HTLV promAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-M100/125/147L-siResist
Plasmid#49856PurposeEncodes human connexin 43 with M100, M125, and M147 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
ExpressionMammalianMutationMethionine100, Methionine 125, and Methionine 147…PromoterCMVAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only