We narrowed to 8,864 results for: aav
-
Plasmid#104054PurposeAn AAV genome encoding expression of the nuclear localized fluorescent protein tdTomato from the MBP promoterDepositorInsert2xNLS-tdTomato
UseAAVTagsNLSPromoterMBPAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-mCherry
Plasmid#50459PurposeDouble floxed mCherry under the control of human synapsin promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertmCherry
UseAAVTagsN/APromoterhuman Synapsin 1Available SinceMarch 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-NES-FRCaMPi
Plasmid#232838PurposeAAV transfer plasmid for Syn-mediated expression of FRCaMPiDepositorInsertNES-SomaFRCaMPi
UseAAVTagsnuclear export sequenceExpressionMammalianPromoterSynAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-TeNT
Plasmid#240990PurposeExpresses mCherry-TeNT in mammalian cells; for AAV transduction of neuronsDepositorInsertmCherry-V5-TeNT
UseAAVTagsV5 (internal)ExpressionMammalianAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM3D(Gq)-mCherry
Plasmid#50474PurposeGq-coupled hM3D DREADD fused with mCherry under the control of human synapsin promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserthM3D(Gq)-mCherry (CHRM3 Human)
UseAAVTagsmCherryMutationSee supplemental documents for DREADD mutationsPromoterhuman Synapsin 1Available SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-trkB.DN-mCherry
Plasmid#121502PurposeExpresses trkB.T1 fused with mCherry in a cre dependent manner.DepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-MCP-huADARE488QT490A
Plasmid#159922PurposeFusion of MS2 coat protein to Human ADAR2 E488QT490A, under Ef1a promoter, with WPRE. AKA 116v5DepositorAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-pAce-Kv2.1PR
Plasmid#195523PurposeGreen fluorescent, positive response-polarity voltage indicator under the control of synapsin promoter; soma-targetedDepositorInsertpAce-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationAce-mNeon 78K, 81D, 92N, 178F; SY linkerPromoterSynapsinAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-pur-CAG-Bi-DREADD
Plasmid#159457PurposeAAVS1 targeting donor plasmid with Bi-DREADD expression cassette (hM3Dq-mCherry-P2A-HA-KORD) and puromycin selection geneDepositorInsertBi-DREADD
ExpressionMammalianMutationfusion protein of hM3Dq-mCherry and HA-KORD seper…PromoterCAGAvailable SinceDec. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP207-AAV-CMV-MCS-pA
Plasmid#78318PurposeAAV vector backbone containing a CMV promoter followed by a multiple cloning site(MCS) followed by a poly-Adenylation Signal (pA)DepositorTypeEmpty backboneUseAAVPromoterCytomegalo Virus(CMV)Available SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-hSyn-mCherry
Plasmid#87916PurposesgRNA expressing AAV construct with a mCherry reporter driven by hSyn promoter. (replaced the GFP in pX552 from Zhang lab with mCherry)DepositorInsertmCherry
UseAAV and CRISPRExpressionMammalianPromoterhSynAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-SA-2A-NEO-CAG-RTTA3
Plasmid#60431Purposeneomycin resistance; constitutive promoter driving reverse tet activatorDepositorInsertrtTA3
UseZfn donorPromoterCAGAvailable SinceFeb. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-seTurboID
Plasmid#237886PurposeAAV vector for Cre-dependent expression of seTurboIDDepositorInsertseTurboID
UseAAV and Cre/LoxTagsFLAG tagExpressionMammalianPromoterCAGAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_r5-HT1.0
Plasmid#208719PurposeExpresses the red 5-HT sensor GRAB_r5-HT1.0 in neuronsDepositorInsertRed fluorescent 5-HT sensor GRAB_r5-HT1.0
UseAAVPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-NFIA+SOX9
Plasmid#129455PurposeInducible overexpression of NFIA and Sox9 in human cells.DepositorAvailable SinceMarch 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc17a6
Plasmid#124847PurposeMutagenesis of Slc17a6 with SauCas9DepositorInsertSlc17a6 gRNA (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(cyto).iATPSnFR2.A95A.A119L.HaloTag
Plasmid#209653PurposeExpression of iATPSnFR2, low affinityDepositorInsertiATPSnFR2.A95A.A119L.HaloTag
UseAAVMutationA95A.A119LPromoterCAGAvailable SinceNov. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-DTR-GFP
Plasmid#124364Purposeconditional expression of a diphtheria toxin receptor (DTR)–GFP fusion proteinDepositorHas ServiceAAV2InsertDTR-GFP
UseAAVTagsGFPPromoterChicken B-actinAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-sCAG-eGFP-ACAP1
Plasmid#203800PurposeAAV vector plasmid expressing human ACAP1 fused to eGFP under a short variant of the CAG (sCAG) promoterDepositorAvailable SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only