We narrowed to 548 results for: PA-GFP
-
Plasmid#40837PurposeTarget RNAs used to determine complementarity requirements for in vitro tailing and degradationDepositorInsertlet-7–mm21
UseMirna reporterTagsEGFPExpressionInsectPromoterActin5CAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-rtTA-IRES-nls-EGFP-WPRE-bGH-pA (JDW 410)
Plasmid#229807PurposeA CAGGS driven tet-on transactivator with an nls-EGFP reporterDepositorInsertrtTA-IRES-nls-EGFP
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti EFS-GFP-pa (opposite orientation)- TRE3g-Flag-GluN2B-WPRE
Plasmid#233047PurposeTo express GFP from an EFS promoter in the 3'-5' direction and Flag-GluN2B from a TRE3g promoter in the 5'-3' directionDepositorInsertGFP and GluN2B
UseLentiviralTagsFlag and GFPAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJEP10-AAV-U6/TO-gRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82706PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP11-AAV-U6/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82705PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82702PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJEP15-AAV-H1/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82701PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAS-8 (seed1-8)
Plasmid#40843PurposeTarget RNAs used to determine complementarity requirements for in vitro tailing and degradationDepositorInsertlet-7–seed1-8
UseMirna reporterTagsEGFPExpressionInsectPromoterActin5CAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAS-7 (mm12-21)
Plasmid#40842PurposeTarget RNAs used to determine complementarity requirements for in vitro tailing and degradationDepositorInsertlet-7–mm12-21
UseMirna reporterTagsEGFPExpressionInsectPromoterActin5CAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAS-6 (mm17-21)
Plasmid#40841PurposeTarget RNAs used to determine complementarity requirements for in vitro tailing and degradationDepositorInsertlet-7–mm17-21
UseMirna reporterTagsEGFPExpressionInsectPromoterActin5CAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAS-5 (mm18-21)
Plasmid#40840PurposeTarget RNAs used to determine complementarity requirements for in vitro tailing and degradationDepositorInsertlet-7–mm18-21
UseMirna reporterTagsEGFPExpressionInsectPromoterActin5CAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAS-4 (mm19-21)
Plasmid#40839PurposeTarget RNAs used to determine complementarity requirements for in vitro tailing and degradationDepositorInsertlet-7–mm19-21
UseMirna reporterTagsEGFPExpressionInsectPromoterActin5CAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAS-3 (mm20-21)
Plasmid#40838PurposeTarget RNAs used to determine complementarity requirements for in vitro tailing and degradationDepositorInsertlet-7–mm20-21
UseMirna reporterTagsEGFPExpressionInsectPromoterActin5CAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAS-16 (mm14-21)
Plasmid#40851PurposeTarget RNAs used to determine complementarity requirements for in vitro tailing and degradationDepositorInsertlet-7–mm14-21
UseMirna reporterTagsEGFPExpressionInsectPromoterActin5CAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAS-15 (mm15-21)
Plasmid#40850PurposeTarget RNAs used to determine complementarity requirements for in vitro tailing and degradationDepositorInsertlet-7–mm15-21
UseMirna reporterTagsEGFPExpressionInsectPromoterActin5CAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAS-12 (mm1-8)
Plasmid#40847PurposeTarget RNAs used to determine complementarity requirements for in vitro tailing and degradationDepositorInsertlet-7–mm1-8
UseMirna reporterTagsEGFPExpressionInsectPromoterActin5CAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
LeGO-iG2-wPRE-pA
Plasmid#60489PurposeeGFP-expressing lentiviral vector with IRES and pA-signal; suitable for use as NRTLV (non-reverse transcribable lentiviral vector)DepositorInsertIRES-eGFP; wPRE; BGH-pA
UseLentiviralExpressionMammalianAvailable SinceOct. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
MXS_PA-GFP
Plasmid#62412PurposeMXS_chaining vector with PA-GFPDepositorInsertPA-GFP
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJEP12-AAV-H1/TO-L-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82704PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only