We narrowed to 14,266 results for: cas9
-
Plasmid#85174PurposeExpresses YE1-BE3 in mammalian cellsDepositorInsertYE1-BE3
ExpressionMammalianPromoterCMVAvailable SinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CibN-dCas9
Plasmid#60551PurposeExpresses CibN-dCas9 in mammalian cellsDepositorInsertCibN-dCas9
UseCRISPRTagsFLAG and SV40 NLSExpressionMammalianMutationinactivating Cas9 mutations D10A and H840APromoterCMVAvailable SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Neo-CAG-Flpe-ERT2
Plasmid#68460PurposeAAVS1 targeting donor plasmid with Flpe-ERT2 expression cassette and Neo selection geneDepositorInsertmammalian-codon-optimized Flpe recombinase fused with ERT2
UseSynthetic BiologyTagsERT2ExpressionMammalianPromoterCAGAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
PET-B-HiFi SpCas9-NLS-6xHis
Plasmid#207378PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertB-HiFi SpCas9
UseCRISPRTags6xHisExpressionBacterialMutationR691A, amino acids 1005-1013 replaced with two gl…PromoterT7Available SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFB_ROSA26_SpCas9_gRNAs
Plasmid#174703PurposePlasmid containing separate SpCas9 gRNAs for targeted excision of inserted STOP Cassette upstream of reporter alleles found in Ai14 and Ai6 mice. ITRs flank the cassette for easy vector creation.DepositorInsertSpCas9 dual gRNAs
UseAAVAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTW045
Plasmid#185690PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNAs
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW037
Plasmid#185688PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133A
Plasmid#69275PurposeGolden Gate entry vector; 3rd gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG>nls-Cas9-nls-2A-Citrine-EcoRI/NotI
Plasmid#169097PurposeCas9 and Citrine expression in transfected cellsDepositorInsertCas9-2A-Citrine
ExpressionMammalianAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-nEF-dCas9
Plasmid#106430PurposeExpresses SpdCas9 from the nEF promoter in AAV backboneDepositorInsertnEF-dCas9
UseAAV and CRISPRTagsHA-NLS and NLSExpressionMammalianPromoternEFAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001148862)
Plasmid#80263Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pICSL11085_GG_Wheat_live_Cas9_for
Plasmid#126881PurposeEncodes a wheat codon optimized Cas9 module in forward direction for golden gate cloning of genome editing binary plasmids.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Dlg4-GFP KI
Plasmid#131477PurposeEndogenous tagging of PSD95: C-terminal (amino acid position: R721)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO5.sgRNA.EFS.PAC
Plasmid#57825PurposeLentiviral Vector for Sp sgRNA delivery without SpCas9, Puromycin resistance, EFS Promoter drivenDepositorInsertssgRNA
EFS
PAC
UseCRISPR and LentiviralAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177342PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequenceDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterCMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSA127 A2UCOE-Cas9-BFP
Plasmid#249151PurposeOverexpression of SpCas9-BFP and blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-Cas9-TagBFP
UseCRISPR; Cp36 donor dnaExpressionMammalianPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1RA-PGK-Puro
Plasmid#110860PurposeLentiviral vector for constitutive expression of Cas9-HF1RA in mammalian cells (codon optimized)DepositorInsertCas9-HF1RA
UseLentiviralTagsFLAGMutationR661A, Q695A, Q926A, and NLS sequence at the N-te…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSP2266
Plasmid#70705PurposeBacterial expression plasmid for SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialPromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB-sgRNA(MS2)
Plasmid#102560PurposePiggybac transposon sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. Contains BbsI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR; Piggybac transposonExpressionMammalianPromoterU6Available SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only