We narrowed to 1,854 results for: rigi
-
Plasmid#110980PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertconserved Plasmodium protein (PF3D7_0929900 Synthetic)
UseTagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_0511400-COMP-blac-flag-his
Plasmid#110974PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertconserved Plasmodium protein (PF3D7_0511400 Synthetic)
UseTagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1333300-COMP-blac-flag-his
Plasmid#110972PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInserttransmembrane protein Tmp21 homologue, putative (PF3D7_1333300 Synthetic)
UseTagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1462300-COMP-blac-flag-his
Plasmid#110970PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertconserved Plasmodium protein (PF3D7_1462300 Synthetic)
UseTagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1352500-COMP-blac-flag-his
Plasmid#110969PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertthioredoxin-related protein, putative (PF3D7_1352500 Synthetic)
UseTagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_0912400-COMP-blac-flag-his
Plasmid#110966PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertalkaline phosphatase, putative (PF3D7_0912400 Synthetic)
UseTagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PIESP15-COMP-blac-flag-his
Plasmid#110958PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertparasite-infected erythrocyte surface protein (PIESP15) (PF3D7_0103900 Synthetic)
UseTagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1105300-COMP-blac-flag-his
Plasmid#110960PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertconserved Plasmodium protein, unknown function (PF3D7_1105300 Synthetic)
UseTagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
AIMTOR A757
Plasmid#140829PurposeAIMTOR BRET Biosensor containing a mutated non-phosphorylable ULK1 peptide to use as a control constuct in parrallel with AIMTOR T757DepositorInsertAIMTOR A757 (ULK1 Human)
UseTagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…PromoterAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
UseTagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AIMTOR T757
Plasmid#140828PurposeAIMTOR T757 contains a cytoplasmic mTOR Activity Reporter derived from hu ULK1 protein boxed between BRET-compatible entities (Ypet and Nanoluciferase) to measure mTOR activity in living cellsDepositorInsertAIMTOR T757 (ULK1 Human)
UseTagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…PromoterAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRISPi Kit
Plasmid Kit#1000000136PurposeCRISPi Kit contains elements for CRISPR/Cas9 mediated genome editing in yeast P. pastoris. Contains 7 different backbone (BB3) vectors with Cas9/ sgRNA expression cassettes with NTC, hphMX, or kanMX.DepositorAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
GoldenPiCS Kit
Plasmid Kit#1000000133PurposeGoldenPiCS: plasmid kit for engineering in P. pastoris (GoldenMOCS based). Overexpression of up to eight transcription units. 20 promoters, 10 terminators, 4 selection markers and 4 integration sitesDepositorAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
S. cerevisiae Advanced Gateway Destination Vectors
Plasmid Kit#1000000011PurposeYeast (S. cerevisiae) Gateway Destination Vectors for tagging and gene expression. Has variety of promoters, origin of replications, auxotrophic markers, and N- or C-terminal fusion proteinsDepositorAvailable SinceJuly 16, 2011AvailabilityAcademic Institutions and Nonprofits only