We narrowed to 2,670 results for: c-Myc-promoter
-
Plasmid#163634PurposeL5 Integrase delivery plasmid to allow integration of L5 attP only plasmids (e.g. plRL61, ID #163633).DepositorInsertL5 Integrase
ExpressionBacterialPromoterMycobacterial Optimized Promoter (MOP) and Tet-OnAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGWB701NL3F10H
Plasmid#141288PurposeNo promoter, C-terminal NLUC:3xFlag:10xHis tag, attR1-Cmr-ccdB-attR2-NLUC:3xFlag:3xHis-TNOS (modified pGWB401, pPZP backbone, SpcR for bacteria, Tunicamycin R for plant)DepositorTypeEmpty backboneUseLuciferase; GatewayTagsFLAG (x3), HIS (x10), and NLUCExpressionPlantAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST-Tstem(5A)-GFP
Plasmid#162502PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. The mutated stem region of Tac is inserted within ST.DepositorTagsGFPExpressionMammalianMutationThe mutated Tac stem region is inserted within ST…Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST-Tstem-GFP
Plasmid#162501PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. The stem region of Tac is inserted within ST.DepositorTagsGFPExpressionMammalianMutationThe Tac stem region is inserted within ST6Gal1Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3
Plasmid#221112PurposeFAP tagged STE3 (N-terminally tagged, optimized for yeast expression) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3
ExpressionYeastPromoterSTE3Available SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-MFA-Igkappa-FAPoptim-STE3
Plasmid#221114PurposeFAP tagged STE3 (N-terminally tagged, optimized for yeast expression) under the Tef1 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3-K424R
Plasmid#221119PurposeFAP tagged STE3-K424R mutant (N-terminally tagged, optimized) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3-K424R
ExpressionYeastMutationSTE3 mutantK424RPromoterSTE3Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-A3A(N57Q)-BE3
Plasmid#158157PurposeT7 promoter bacterial expression plasmid for hAPOBEC3A(N57Q)-BE3 with N-terminal 6xHis-tag and C-terminal SV40 NLSDepositorInsert6xHis-hA3A(N57Q)-XTEN linker-hSpCas9n(D10A)-UGI-SV40NLS
Tags6xHis tag on N-terminusExpressionBacterialPromoterT7Available SinceNov. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nprot-HF_GC3opt
Plasmid#157732Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 N protein under control of a tetracycline-inducible promoterDepositorInsertNprot-HF_GC3opt (N SARS-CoV-2)
TagsHis8-FlagExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 10, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-FRT-TO-Nsp8-Nsp7-HF_GC3opt
Plasmid#157702Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 Nsp8-Nsp7 fusion protein under control of a tetracycline-inducible promoterDepositorInsertNsp8-Nsp7-HF_GC3opt (ORF1ab SARS-CoV-2)
TagsHis8-FlagExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
p7XC3GH
Plasmid#47066PurposeFX cloning E.coli expression vector with T7 promoter and C-terminal 3C protease cleavage site, GFP and 10x His tagsDepositorTypeEmpty backboneTags3C protease site (PreScission site), GFP, and dec…ExpressionBacterialPromoterT7Available SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
FUW-Luc-mCherry-puro
Plasmid#183685PurposeLentiviral vector expressing luciferase and mCherry.DepositorInsertLuc-E2A-mCherry-T2A-PuroR
UseLentiviralPromoterHuman Ubiquitin C (UbC) promoterAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYEXC3GH
Plasmid#49027PurposeFX cloning Saccharomyces cerevisiae expression vector with GAL1 promoter and C-terminal 3C protease cleavage site, GFP and 10x His tagDepositorTypeEmpty backboneTags3C protease site (PreScission site), GFP, and dec…ExpressionYeastPromoterGAL1Available SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYEXC3H
Plasmid#49026PurposeFX cloning Saccharomyces cerevisiae expression vector with GAL1 promoter and C-terminal 3C protease cleavage site and 10x His tagDepositorTypeEmpty backboneTags3C protease site (PreScission site) and decaHis (…ExpressionYeastPromoterGAL1Available SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
PTGR-PS2
Plasmid#237442PurposeExpressing PS2 S-layer from C. glutamicum under its native promoterDepositorInsertcpsB
ExpressionBacterialAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS05
Plasmid#230069PurposeInducible Promoter (anhydrotetracycline-induced, tetO/tetR system), replicates via RepA; ermF, C-terminal 3x-FLAG, R6K ori, RP4 oriTDepositorTypeEmpty backboneUseSynthetic BiologyTags3xFLAGExpressionBacterialPromoteranhydrotetracycline-inducibleAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS04
Plasmid#230068PurposeInducible Promoter (anhydrotetracycline-induced, tetO/tetR system), integrates via IntN1; ermF, C-terminal 3x-FLAG, R6K ori, RP4 oriTDepositorTypeEmpty backboneUseSynthetic BiologyTags3xFLAGExpressionBacterialPromoteranhydrotetracycline-inducibleAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAD-LacI
Plasmid#46394PurposeOverproduction of LacIDepositorInsertLacI
Tags6xHIS tagExpressionBacterialMutationsilent T to C mutation at position 19Promoterarabinose promoterAvailable SinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
TGT-His
Plasmid#138201PurposeExpresses E. Coli TGT with a C-terminal His TagDepositorInsertE Coli tRNA Guanine Transglycosylase-His
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only