We narrowed to 4,633 results for: DUR
-
Plasmid#246271PurposeRab8 sensor acceptorDepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pCAGGS-mCherry-Rabenosyn5[439-503]-mCherry
Plasmid#246251PurposeRab4 sensor acceptorDepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-SUMO-SHP2-N-SH2(E76K)-Avi
Plasmid#245187PurposeProduction of N-terminally His-SUMO-tagged and C-terminally Avi-tagged SH2 domainDepositorInsertSHP2 N-SH2
TagsAvi and His-SUMOExpressionBacterialMutationE76KAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-SUMO-SHP2-C-SH2(WT)-Avi
Plasmid#245188PurposeProduction of N-terminally His-SUMO-tagged and C-terminally Avi-tagged SH2 domainDepositorInsertSHP2 C-SH2
TagsAvi and His-SUMOExpressionBacterialMutationwild-typeAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-SUMO-SHP2-C-SH2(E139D)-Avi
Plasmid#245190PurposeProduction of N-terminally His-SUMO-tagged and C-terminally Avi-tagged SH2 domainDepositorInsertSHP2 C-SH2
TagsAvi and His-SUMOExpressionBacterialMutationE139DAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSB-XPRESSO-CoChR-EGFP
Plasmid#237297PurposeSleeping Beauty XPRESSO vector for optogenetic CoChR-eGFP expressionDepositorInsertCoChR
TagseGFPExpressionMammalianPromoterCAGAvailable SinceAug. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKII-RFP-p2A-DAAO-NES
Plasmid#238918PurposeMammalian expression of DAAO with a nuclear export signal and RFP as a reporter in excitatory neuronsDepositorInsertRFP-p2A-DAAO-NES
UseAAVExpressionMammalianPromoterCaMKIIalfaAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CMV-RFP-p2A-DAAO-NES
Plasmid#238920PurposeExpression of DAAO with a nuclear export signal and RFP as a reporter in mammalian cellsDepositorInsertRFP-p2A-DAAO-NES
UseAAVExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-miR30-shJAG1 #4
Plasmid#171197PurposeRetroviral vector for U6 promoter driven expression empty miR30 based shJAG1 #4 (to be used in conjunction with Phoenix packaging cells).DepositorInsertshJAG1 #4
UseRetroviralExpressionMammalianPromoterU6Available SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha1_CBS-FRT-OCS-BeYDVRepRepA-tNos (GB4646)
Plasmid#225438PurposeTranscriptional unit for copper- and flipase-regulated BeYDV Rep/RepA. OCSt, flanked by FRT sites, is embedded in the 5'UTR of miniDFR.DepositorInsertCBS-FRT-OCS-BeYDVRepRepA-tNos
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha2_BeYDV geminino 1.0 (GB4480)
Plasmid#225436PurposeBeYDV LIR1:2nd intron+eGFP CDS+Ter35S+p35S+1st intron:LIR1 in alpha2. Deconstructed replicon that needs BeYDV Rep for circularization and, thus, replication and eGFP transcription.DepositorInsertBeYDV geminino 1.0
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha1_CBS-att-OCS-BeYDVRep-RepA-tNos (GB4643)
Plasmid#225437PurposeTranscriptional unit for the copper and PhiC31 regulated expression of BeYDV Rep/RepA.DepositorInsertCBS-att-OCS-BeYDVRep/RepA-tNos
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUPD2_miniDFR-FRT-OCSterm-FRT-miniDFR (GB4642)
Plasmid#225430PurposeOCS terminator flanked by two flippase recognition target (FRT) sites located at position 112 of the SlDFR minimal promoterDepositorInsertminiDFR-FRT-OCSterm-FRT-miniDFR
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUPD2_miniDFR-att-OCSterm-att-miniDFR (GB4641)
Plasmid#225431PurposeOCS terminator flanked by two att sites of PhiC31 integrase located at position 112 of the SlDFR minimal promoterDepositorInsertminiDFR-att-OCSterm-att-miniDFR
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLXB3o1 HygR-MAR10-gemiGFP-MAR10 (GB4684)
Plasmid#225439PurposeModule for stable transformation of Geminino 1.0-eGFP flanked by two MAR10 insulators and next to a Hygromycin resistance cassette.DepositorInsertHygR-MAR10-gemiGFP-MAR10
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only