We narrowed to 5,024 results for: GCA;
-
Plasmid#75602Purpose3rd generation lentiviral gRNA plasmid targeting human TRIB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRN3P-HA-Suv4-20h1mut
Plasmid#86690PurposeFor transcription of of Suv4-20h1mut mRNA preceded by an HA-tag in 5'DepositorInserthistone-lysine N-methyltransferase KMT5B mutant (Kmt5b Mouse)
TagsHAMutationmutated region NHDC (asparagine 273 to cysteine 2…PromoterT3Available SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-MAVS-ts1
Plasmid#174274PurposeMAVS knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circHUWE1_2
Plasmid#215235PurposeSupression of shcircHUWE1(19,20)_2 expressionDepositorInsertcircHUWE1 shRNA 2 (HUWE1 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-ARNTL-shRNA3
Plasmid#166915PurposeLentivirus for inducible knockdown of human ARNTL(BMAL1)DepositorAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-AGO2 ts2
Plasmid#115854PurposeAGO2 knockdownDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
ROCK1 gRNA (BRDN0001147709)
Plasmid#77593Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ZAP70 gRNA (BRDN0001487050)
Plasmid#77956Purpose3rd generation lentiviral gRNA plasmid targeting human ZAP70DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROR1 gRNA (BRDN0001162245)
Plasmid#76043Purpose3rd generation lentiviral gRNA plasmid targeting human ROR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKIF1C-2xFLAG
Plasmid#130979PurposeExpression of KIF1C-2xFLAG in mammalian cells.DepositorInsertKIF1C-2xFLAG (KIF1C Human)
Tags2xFLAGExpressionMammalianMutation4 silent mutations that make this construct resis…PromoterCMVAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
VRK1 gRNA (BRDN0001149172)
Plasmid#75525Purpose3rd generation lentiviral gRNA plasmid targeting human VRK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKCI gRNA (BRDN0001148989)
Plasmid#76401Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCIDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM24 gRNA (BRDN0001148301)
Plasmid#77888Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM24DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only