31,059 results
-
Plasmid#155021PurposeN-terminal 3xFLAG-tagged CUL3 in a pCMV7.1 vectorDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pYUB28b
Plasmid#37277DepositorTypeEmpty backboneUseMycobacteria shuttle vectorTagsHis-tagExpressionBacterialPromoterT7Available SinceJuly 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSKDuet01
Plasmid#12172DepositorInsertNpuDnaE
TagsHis-GB1ExpressionBacterialAvailable SinceDec. 14, 2007AvailabilityAcademic Institutions and Nonprofits only -
pEB1029
Plasmid#22066DepositorTypeEmpty backboneTagsT25-FlagExpressionBacterialAvailable SinceOct. 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET32a-HD25Q
Plasmid#11508DepositorInserthuntingtin, exon 1, 25 glutamines (HTT Human)
TagsHis, His (out of frame), and TrxExpressionBacterialMutationhuntingtin exon 1 with 25 glutamines, vector m…Available SinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGLO-Magenta-AZA
Plasmid#220784PurposeExpresses a magenta chromoprotein (visible light and fluorescence) with a his-tag and an inducible GFP (araBAD-promoter)DepositorInsertmagenta chromoprotein
Tags6xHisExpressionBacterialAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTarget
Plasmid#214052PurposeExpresses target sequence for Haliangium type III CRISPR-Cas complex; identical to pNon-target (Addgene plasmid # 214053) but contains a protospacer.DepositorInsertTarget sequence
UseTarget rna plasmidExpressionBacterialPromotertrc promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNon-target
Plasmid#214053PurposeExpresses non-target sequence for Haliangium type III CRISPR-Cas complex; identical to pTarget (Addgene plasmid # 214052) but does not contain a protospacer.DepositorInsertNon-target sequence
UseNon-target rna plasmidExpressionBacterialPromotertrc promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET30-2-GPD1L
Plasmid#83912Purposestable overexpressionDepositorInsertglycerol-3-phosphate dehydrogenase 1-like (GPD1L Human)
Tags6x His tagsExpressionBacterialPromoterT7Available SinceOct. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1-N-HA
Plasmid#119756PurposeAllows cloning of gene of interest into bacterial expression vector with PreScission Protease cleavable N-terminal GST tag, and a retained N-terminal HA tag.DepositorTypeEmpty backboneTagsGST and HAExpressionBacterialPromotertac promoterAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWT PolI
Plasmid#11721DepositorAvailable SinceAug. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
pDule-Acd82
Plasmid#174099PurposeAcridone82 tRNA synthetase and cognate amber suppressing tRNA derived from M. barkeri for expression in E.coli.DepositorInsertAcridone 82 tRNA synthetase and tRNA
ExpressionBacterialMutationN311S, C313G, V366A, W382TAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX/PD-L1 WT
Plasmid#121466PurposeExpression of GST-human PD-L1 in E. ColiDepositorAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
R6K_tac_mCherry_ChInt
Plasmid#187382Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette containing IPTG-inducible mCherryDepositorInsertmCherry
ExpressionBacterialAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET251-pUC 12xMS2V6 Loxp KANr Loxp
Plasmid#104392PurposeYeast endogenous mRNA taggingDepositorInsert12xMS2V6
ExpressionBacterialMutationAll Loops are U-variants, interspaced by 50 nucle…Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
His-SUMO-Rad23A_pET11a
Plasmid#169124Purposeexpression of proteinDepositorAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSF-CjPglB
Plasmid#199305PurposepSN18 derivative encoding C.jejuni PglB with C-terminal FLAG epitope tagDepositorInsertCjPglB with flag tag
TagsFlag tagExpressionBacterialPromoterpBADAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pYTRW22K_7Ti1
Plasmid#177293Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcR and LacZDepositorInsertlacZ
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only