We narrowed to 430 results for: AAVS1
-
Plasmid#214013PurposeExpression of cardiac troponin TDepositorInsertTNNT2 (TNNT2 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSL5069 (pDonor(AAVS1),CRISPR_Pse)
Plasmid#200904PurposeEncodes a mini-transposon derived from Pseudoalteromonas Tn7016 with a splice acceptor-T2A-PuroR-T2A-eGFP cargo, and a CRISPR RNA under a U6 promoter. Total transposon size = 2,024 bp.DepositorInsertMini Tn7016 (AAVS1 NGS), PseCRISPR (tSL425)
ExpressionMammalianAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro cTnT FUCCI
Plasmid#136935Purposedonor plasmid for cardiac-specific FUCCI expression in human cellsDepositorInsertTroponin T promoter
UseSynthetic BiologyExpressionMammalianPromotercTnTAvailable SinceApril 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-Puro-PECAM1-Neo
Plasmid#201054PurposeEndothelial promoter driven neomycin selection cassetteDepositorInsertAdeno-associated virus integration site 1 (AAVS1 Human)
UseAAVTagsNeomycin resistancePromoterPECAM1Available SinceJuly 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-AAVS1_sgRNA
Plasmid#183890PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and sgRNA targeting the AAVS1 in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-pur-CAG-mCherry
Plasmid#159458PurposeAAVS1 targeting donor plasmid with mCherry expression cassette and puromycin selection geneDepositorInsertmCherry
ExpressionMammalianPromoterCAGAvailable SinceDec. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSL3936 (pDonor(AAVS1)_Pse)
Plasmid#200903PurposeEncodes a mini-transposon derived from Pseudoalteromonas Tn7016 with a SA-T2A-PuroR-T2A-eGFP cargo. Total transposon size = 2,024 bp.DepositorInsertMini Tn7016 (AAVS1 NGS)
ExpressionMammalianAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 EGFP-p62 HRD
Plasmid#207550PurposeHomologous recombination donor to integrate and expression cassette for eGFP-p62 in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-P62
TagsEGFPExpressionMammalianPromoterEndogenousAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 EGFP-LC3B HRD
Plasmid#207551PurposeHomologous recombination donor to integrate and expression cassette for eGFP-LC3B in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-LC3B
TagsEGFPExpressionMammalianPromoterEndogenousAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 EGFP-GABARAPL1 HRD
Plasmid#207552PurposeHomologous recombination donor to integrate and expression cassette for EGFP-GABRAPL1 in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-GABARAPL1
TagsEGFPExpressionMammalianPromoterEndogenousAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Rhesus AAVS1-CAG-copGFP
Plasmid#84209PurposeRhesus AAVS1 safe harbor gene targeting donor expressing CAG-driven copGFPDepositorInsertsRhesus AAVS1 5’ homology arm
Rhesus AAVS1 3’ homology arm
ExpressionMammalianAvailable SinceNov. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 LAMP1-mNeonGreen HRD
Plasmid#207549PurposeHomologous recombination donor to integrate and expression cassette for LAMP1-mNEONGREEN in the AAVS1 locus of human cellsDepositorInsertTET inducible LAMP1-mNeonGreen
TagsmNeonGreenExpressionMammalianPromoterEndogenousAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-CAG-hCAS9-neo
Plasmid#166026PurposeAAVS1 targeting vector carrying CAG-SpCas9-neoDepositorInsertAAVS1-CAGCas9IRESneo
ExpressionMammalianAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pODN-AAVS1-mNG-CAAX
Plasmid#183870PurposeRepair template for the stable expression of a mNeonGreen-CAAX fusion in human cells using CRISPR/Cas9.DepositorInsertAAVS1 homology arms with CMV-driven mNeonGreen-CAAX fusion (AAVS1 Human)
UseCRISPR; Donor templateTagsmNeonGreen-CAAXExpressionMammalianMutationHomology arms contain point mutations to remove t…PromoterCMVAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_Puro_hPGK1_hGEM(1-110)_mNG_hSLBP(18-108)
Plasmid#176932PurposeDonor for targeted integration of S-phase specific probe (FUCCI-S) to the AAVS1 safe harbor locusDepositorInserthGEM(1-110)_mNG_hSLBP(18-108)
UseSynthetic BiologyExpressionMammalianPromoterPGK1Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-EF1a-mTagRFP-T-CAAX
Plasmid#167973PurposeAAVS1 targeting repair templateDepositorUseCRISPR; Donor templateTagsmTagRFP-T-CAAXExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro Xlone SOX17
Plasmid#179838PurposeDoxycycline-inducible expression of human SOX17DepositorInsertSOX17 (SOX17 Human)
UseAAV, CRISPR, Synthetic Biology, and TALEN ; Donor…ExpressionMammalianPromoterTRE3GSAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTBL437 AAVS1 EQR sgRNA
Plasmid#126447PurposeTo cut the human AAVS1 locus for integration.DepositorInsertspacer against human AAVS1 safe-harbor locus with NGAG PAM
ExpressionMammalianPromoterhuman U6Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pODN-AAVS1-mR2-CAAX
Plasmid#183871PurposeRepair template for the stable expression of a mRuby2-CAAX fusion in human cells using CRISPR/Cas9.DepositorInsertAAVS1 homology arms with CMV-driven mRuby2-CAAX fusion (AAVS1 Human)
UseCRISPR; Donor templateTagsmRuby2-CAAXExpressionMammalianMutationHomology arms contain point mutations to remove t…PromoterCMVAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only